EIF4B cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52012-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EIF4B Reagents
CRO Services
Product recommended

All EIF4B Reagents
EIF4B cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1836 bp
Description
Full length Clone DNA of Mouse eukaryotic translation initiation factor 4B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF4B cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2310046H11Rik cDNA ORF Clone, Mouse;AL024095 cDNA ORF Clone, Mouse;C85189 cDNA ORF Clone, Mouse;Eif4a2 cDNA ORF Clone, Mouse
EIF4B Background Information
Full Name
eukaryotic translation initiation factor 4B

EIF4B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF4B cDNA ORF Clone in Cloning Vector, Rat RG89356-U
EIF4B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89356-ACGLN

EIF4B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF4B cDNA ORF Clone in Cloning Vector, Mouse MG52012-G
EIF4B cDNA ORF Clone, Mouse, untagged MG52012-UT
EIF4B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52012-ACG
EIF4B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52012-ACGLN
EIF4B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52012-ANG
EIF4B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52012-ACR
EIF4B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52012-ANR
EIF4B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52012-CF
EIF4B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52012-NF
EIF4B cDNA ORF Clone, Mouse, C-His tag MG52012-CH
EIF4B cDNA ORF Clone, Mouse, N-His tag MG52012-NH
EIF4B cDNA ORF Clone, Mouse, C-HA tag MG52012-CY
EIF4B cDNA ORF Clone, Mouse, N-HA tag MG52012-NY
EIF4B cDNA ORF Clone, Mouse, C-Myc tag MG52012-CM
EIF4B qPCR Primer Pairs, Mouse MP201885

EIF4B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF4B cDNA ORF Clone in Cloning Vector, Human HG13867-G
EIF4B cDNA ORF Clone, Human, untagged HG13867-UT
EIF4B cDNA ORF Clone, Human, C-GFPSpark® tag HG13867-ACG
EIF4B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13867-ACGLN
EIF4B cDNA ORF Clone, Human, N-GFPSpark® tag HG13867-ANG
EIF4B cDNA ORF Clone, Human, C-OFPSpark® tag HG13867-ACR
EIF4B cDNA ORF Clone, Human, N-OFPSpark® tag HG13867-ANR
EIF4B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13867-CF
EIF4B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13867-NF
EIF4B cDNA ORF Clone, Human, C-His tag HG13867-CH
EIF4B cDNA ORF Clone, Human, N-His tag HG13867-NH
EIF4B cDNA ORF Clone, Human, C-HA tag HG13867-CY
EIF4B cDNA ORF Clone, Human, N-HA tag HG13867-NY
EIF4B cDNA ORF Clone, Human, C-Myc tag HG13867-CM
EIF4B cDNA ORF Clone, Human, N-Myc tag HG13867-NM
EIF4B qPCR Primer Pairs, Human HP102538
info info
添加购物车成功! 添加购物车失败!