EEF2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51203-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EEF2 Reagents
CRO Services
Product recommended

All EEF2 Reagents
EEF2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2577 bp
Description
Full length Clone DNA of Mouse eukaryotic translation elongation factor 2 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EEF2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Ef-2 cDNA ORF Clone, Mouse
EEF2 Background Information
Full Name
eukaryotic translation elongation factor 2

EEF2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Rat RG81613-G
EEF2 cDNA ORF Clone, Rat, untagged RG81613-UT
EEF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81613-ACG
EEF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81613-ACGLN
EEF2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81613-ANG
EEF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81613-ACR
EEF2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81613-ANR
EEF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81613-CF
EEF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81613-NF
EEF2 cDNA ORF Clone, Rat, C-His tag RG81613-CH
EEF2 cDNA ORF Clone, Rat, N-His tag RG81613-NH
EEF2 cDNA ORF Clone, Rat, C-HA tag RG81613-CY
EEF2 cDNA ORF Clone, Rat, N-HA tag RG81613-NY
EEF2 cDNA ORF Clone, Rat, C-Myc tag RG81613-CM
EEF2 cDNA ORF Clone, Rat, N-Myc tag RG81613-NM

EEF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Mouse MG51203-U
EEF2 cDNA ORF Clone, Mouse, untagged MG51203-UT
EEF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51203-ACGLN
EEF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51203-ACG
EEF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51203-ANG
EEF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51203-ACR
EEF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51203-ANR
EEF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51203-CF
EEF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51203-NF
EEF2 cDNA ORF Clone, Mouse, C-His tag MG51203-CH
EEF2 cDNA ORF Clone, Mouse, N-His tag MG51203-NH
EEF2 cDNA ORF Clone, Mouse, N-HA tag MG51203-NY
EEF2 cDNA ORF Clone, Mouse, C-Myc tag MG51203-CM
EEF2 cDNA ORF Clone, Mouse, N-Myc tag MG51203-NM
EEF2 qPCR Primer Pairs, Mouse MP201087

EEF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EEF2 cDNA ORF Clone in Cloning Vector, Human HG13966-G
EEF2 cDNA ORF Clone, Human, untagged HG13966-UT
EEF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13966-ACGLN
EEF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13966-ACG
EEF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13966-ANG
EEF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13966-ACR
EEF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13966-ANR
EEF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13966-CF
EEF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13966-NF
EEF2 cDNA ORF Clone, Human, C-His tag HG13966-CH
EEF2 cDNA ORF Clone, Human, N-His tag HG13966-NH
EEF2 cDNA ORF Clone, Human, C-HA tag HG13966-CY
EEF2 cDNA ORF Clone, Human, N-HA tag HG13966-NY
EEF2 cDNA ORF Clone, Human, C-Myc tag HG13966-CM
EEF2 cDNA ORF Clone, Human, N-Myc tag HG13966-NM
EEF2 qPCR Primer Pairs, Human HP102624
info info
添加购物车成功! 添加购物车失败!