DDX42 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG51992-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All DDX42 Reagents

CRO Services

Product recommended


All DDX42 Reagents

DDX42 cDNA ORF Clone, Mouse, N-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2790 bp
Description
Full length Clone DNA of Mouse DEAD (Asp-Glu-Ala-Asp) box polypeptide 42 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DDX42 cDNA ORF Clone, Mouse, N-HA tag Alternative Names

1810047H21Rik cDNA ORF Clone, Mouse;AW319508 cDNA ORF Clone, Mouse;AW556242 cDNA ORF Clone, Mouse;B430002H05Rik cDNA ORF Clone, Mouse;RHELP cDNA ORF Clone, Mouse;RNAHP cDNA ORF Clone, Mouse;SF3b125 cDNA ORF Clone, Mouse

DDX42 Background Information

Full Name
DEAD (Asp-Glu-Ala-Asp) box helicase 42

DDX42 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DDX42 cDNA ORF Clone in Cloning Vector, Mouse MG51992-G
DDX42 cDNA ORF Clone, Mouse, untagged MG51992-UT
DDX42 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51992-ACGLN
DDX42 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51992-ACG
DDX42 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51992-ANG
DDX42 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51992-ACR
DDX42 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51992-ANR
DDX42 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51992-CF
DDX42 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51992-NF
DDX42 cDNA ORF Clone, Mouse, C-His tag MG51992-CH
DDX42 cDNA ORF Clone, Mouse, N-His tag MG51992-NH
DDX42 cDNA ORF Clone, Mouse, C-HA tag MG51992-CY
DDX42 cDNA ORF Clone, Mouse, C-Myc tag MG51992-CM
DDX42 cDNA ORF Clone, Mouse, N-Myc tag MG51992-NM
DDX42 qPCR Primer Pairs, Mouse MP201865

DDX42 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DDX42 cDNA ORF Clone in Cloning Vector, Human HG21364-U
DDX42 cDNA ORF Clone, Human, untagged HG21364-UT
DDX42 cDNA ORF Clone, Human, C-GFPSpark® tag HG21364-ACG
DDX42 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21364-ACGLN
DDX42 cDNA ORF Clone, Human, N-GFPSpark® tag HG21364-ANG
DDX42 cDNA ORF Clone, Human, C-OFPSpark® tag HG21364-ACR
DDX42 cDNA ORF Clone, Human, N-OFPSpark® tag HG21364-ANR
DDX42 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21364-CF
DDX42 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21364-NF
DDX42 cDNA ORF Clone, Human, C-His tag HG21364-CH
DDX42 cDNA ORF Clone, Human, N-His tag HG21364-NH
DDX42 cDNA ORF Clone, Human, C-HA tag HG21364-CY
DDX42 cDNA ORF Clone, Human, N-HA tag HG21364-NY
DDX42 cDNA ORF Clone, Human, C-Myc tag HG21364-CM
DDX42 cDNA ORF Clone, Human, N-Myc tag HG21364-NM
info info
添加购物车成功! 添加购物车失败!