COX7A2L cDNA ORF Clone, Mouse, untagged

Cat: MG51349-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COX7A2L Reagents
CRO Services
Product recommended

All COX7A2L Reagents
COX7A2L cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
336 bp
Description
Full length Clone DNA of Mouse cytochrome c oxidase subunit VIIa polypeptide 2-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX7A2L cDNA ORF Clone, Mouse, untagged Alternative Names
COX7AR cDNA ORF Clone, Mouse;COX7RP cDNA ORF Clone, Mouse;EB1 cDNA ORF Clone, Mouse;SIG-81 cDNA ORF Clone, Mouse;SIG81 cDNA ORF Clone, Mouse;Silg81 cDNA ORF Clone, Mouse
COX7A2L Background Information
Full Name
cytochrome c oxidase subunit VIIa polypeptide 2 like

COX7A2L cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COX7A2L cDNA ORF Clone in Cloning Vector, Rat RG8A1584-U
COX7A2L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1584-ACGLN

COX7A2L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COX7A2L cDNA ORF Clone in Cloning Vector, Mouse MG51349-U
COX7A2L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51349-ACGLN
COX7A2L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51349-ACG
COX7A2L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51349-ANG
COX7A2L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51349-ACR
COX7A2L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51349-ANR
COX7A2L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51349-CF
COX7A2L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51349-NF
COX7A2L cDNA ORF Clone, Mouse, C-His tag MG51349-CH
COX7A2L cDNA ORF Clone, Mouse, N-His tag MG51349-NH
COX7A2L cDNA ORF Clone, Mouse, C-HA tag MG51349-CY
COX7A2L cDNA ORF Clone, Mouse, N-HA tag MG51349-NY
COX7A2L cDNA ORF Clone, Mouse, C-Myc tag MG51349-CM
COX7A2L cDNA ORF Clone, Mouse, N-Myc tag MG51349-NM
COX7A2L qPCR Primer Pairs, Mouse MP201226

COX7A2L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX7A2L cDNA ORF Clone in Cloning Vector, Human HG21860-U
COX7A2L cDNA ORF Clone, Human, untagged HG21860-UT
COX7A2L cDNA ORF Clone, Human, C-GFPSpark® tag HG21860-ACG
COX7A2L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21860-ACGLN
COX7A2L cDNA ORF Clone, Human, N-GFPSpark® tag HG21860-ANG
COX7A2L cDNA ORF Clone, Human, C-OFPSpark® tag HG21860-ACR
COX7A2L cDNA ORF Clone, Human, N-OFPSpark® tag HG21860-ANR
COX7A2L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21860-CF
COX7A2L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21860-NF
COX7A2L cDNA ORF Clone, Human, C-His tag HG21860-CH
COX7A2L cDNA ORF Clone, Human, N-His tag HG21860-NH
COX7A2L cDNA ORF Clone, Human, C-HA tag HG21860-CY
COX7A2L cDNA ORF Clone, Human, N-HA tag HG21860-NY
COX7A2L cDNA ORF Clone, Human, C-Myc tag HG21860-CM
COX7A2L cDNA ORF Clone, Human, N-Myc tag HG21860-NM
info info
添加购物车成功! 添加购物车失败!