Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, untagged

Cat: MG51387-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytochrome C Oxidase subunit VIc Reagents
CRO Services
Product recommended

All Cytochrome C Oxidase subunit VIc Reagents
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
231 bp
Description
Full length Clone DNA of Mouse cytochrome c oxidase subunit Vic.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytochrome C Oxidase subunit VIc Background Information
Full Name
cytochrome c oxidase subunit VIc

Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytochrome C Oxidase subunit VIc cDNA ORF Clone in Cloning Vector, Mouse MG51387-U
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51387-ACG
Cytochrome C Oxidase subunit VIc Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51387-ACGLN
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51387-ANG
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51387-ACR
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51387-ANR
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51387-CF
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51387-NF
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-His tag MG51387-CH
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-His tag MG51387-NH
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-HA tag MG51387-CY
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-HA tag MG51387-NY
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, C-Myc tag MG51387-CM
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Mouse, N-Myc tag MG51387-NM
Cytochrome C Oxidase subunit VIc qPCR Primer Pairs, Mouse MP201260

Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytochrome C Oxidase subunit VIc cDNA ORF Clone in Cloning Vector, Human HG17030-U
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, untagged HG17030-UT
Cytochrome C Oxidase subunit VIc Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17030-ACGLN
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-GFPSpark® tag HG17030-ACG
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-GFPSpark® tag HG17030-ANG
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-OFPSpark® tag HG17030-ACR
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-OFPSpark® tag HG17030-ANR
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17030-CF
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17030-NF
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-His tag HG17030-CH
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-His tag HG17030-NH
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-HA tag HG17030-CY
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-HA tag HG17030-NY
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, C-Myc tag HG17030-CM
Cytochrome C Oxidase subunit VIc cDNA ORF Clone, Human, N-Myc tag HG17030-NM
info info
添加购物车成功! 添加购物车失败!