CNPase cDNA ORF Clone, Mouse, N-His tag

Cat: MG51390-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CNPase Reagents
CRO Services
Product recommended

All CNPase Reagents
CNPase cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Description
Full length Clone DNA of Mouse 2',3'-cyclic nucleotide 3' phosphodiesterase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNPase cDNA ORF Clone, Mouse, N-His tag Alternative Names
Cnp-1 cDNA ORF Clone, Mouse;Cnp1 cDNA ORF Clone, Mouse;CNPase cDNA ORF Clone, Mouse
CNPase Background Information
Full Name
2',3'-cyclic nucleotide 3' phosphodiesterase

CNPase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNPase cDNA ORF Clone in Cloning Vector, Mouse MG51390-U
CNPase cDNA ORF Clone, Mouse, untagged MG51390-UT
CNPase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51390-ACG
CNPase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51390-ACGLN
CNPase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51390-ANG
CNPase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51390-ACR
CNPase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51390-ANR
CNPase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51390-CF
CNPase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51390-NF
CNPase cDNA ORF Clone, Mouse, C-His tag MG51390-CH
CNPase cDNA ORF Clone, Mouse, C-HA tag MG51390-CY
CNPase cDNA ORF Clone, Mouse, N-HA tag MG51390-NY
CNPase cDNA ORF Clone, Mouse, C-Myc tag MG51390-CM
CNPase cDNA ORF Clone, Mouse, N-Myc tag MG51390-NM
CNPase qPCR Primer Pairs, Mouse MP201263

CNPase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNPase cDNA ORF Clone in Cloning Vector, Human HG14205-G
CNPase cDNA ORF Clone, Human, untagged HG14205-UT
CNPase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14205-ACGLN
CNPase cDNA ORF Clone, Human, C-GFPSpark® tag HG14205-ACG
CNPase cDNA ORF Clone, Human, N-GFPSpark® tag HG14205-ANG
CNPase cDNA ORF Clone, Human, C-OFPSpark® tag HG14205-ACR
CNPase cDNA ORF Clone, Human, N-OFPSpark® tag HG14205-ANR
CNPase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14205-CF
CNPase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14205-NF
CNPase cDNA ORF Clone, Human, C-His tag HG14205-CH
CNPase cDNA ORF Clone, Human, N-His tag HG14205-NH
CNPase cDNA ORF Clone, Human, C-HA tag HG14205-CY
CNPase cDNA ORF Clone, Human, N-HA tag HG14205-NY
CNPase cDNA ORF Clone, Human, C-Myc tag HG14205-CM
CNPase cDNA ORF Clone, Human, N-Myc tag HG14205-NM
CNPase qPCR Primer Pairs, Human HP102855
info info
添加购物车成功! 添加购物车失败!