HP1 alpha cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51641-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HP1 alpha Reagents
CRO Services
Product recommended

All HP1 alpha Reagents
HP1 alpha cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Mouse chromobox 5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HP1 alpha cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2610029O15Rik cDNA ORF Clone, Mouse;C75991 cDNA ORF Clone, Mouse;HP1 cDNA ORF Clone, Mouse;Hp1a cDNA ORF Clone, Mouse;Hp1alpha cDNA ORF Clone, Mouse
HP1 alpha Background Information
Full Name
chromobox homolog 5

HP1 alpha cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
HP1 alpha cDNA ORF Clone in Cloning Vector, Mouse MG51641-G
HP1 alpha cDNA ORF Clone, Mouse, untagged MG51641-UT
HP1 alpha cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51641-ACG
HP1 alpha Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51641-ACGLN
HP1 alpha cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51641-ANG
HP1 alpha cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51641-ACR
HP1 alpha cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51641-ANR
HP1 alpha cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51641-CF
HP1 alpha cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51641-NF
HP1 alpha cDNA ORF Clone, Mouse, C-His tag MG51641-CH
HP1 alpha cDNA ORF Clone, Mouse, N-His tag MG51641-NH
HP1 alpha cDNA ORF Clone, Mouse, C-HA tag MG51641-CY
HP1 alpha cDNA ORF Clone, Mouse, N-HA tag MG51641-NY
HP1 alpha cDNA ORF Clone, Mouse, N-Myc tag MG51641-NM
HP1 alpha qPCR Primer Pairs, Mouse MP201514

HP1 alpha cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HP1 alpha cDNA ORF Clone in Cloning Vector, Human HG14669-G
HP1 alpha cDNA ORF Clone, Human, untagged HG14669-UT
HP1 alpha Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14669-ACGLN
HP1 alpha cDNA ORF Clone, Human, C-GFPSpark® tag HG14669-ACG
HP1 alpha cDNA ORF Clone, Human, N-GFPSpark® tag HG14669-ANG
HP1 alpha cDNA ORF Clone, Human, C-OFPSpark® tag HG14669-ACR
HP1 alpha cDNA ORF Clone, Human, N-OFPSpark® tag HG14669-ANR
HP1 alpha cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14669-CF
HP1 alpha cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14669-NF
HP1 alpha cDNA ORF Clone, Human, C-His tag HG14669-CH
HP1 alpha cDNA ORF Clone, Human, N-His tag HG14669-NH
HP1 alpha cDNA ORF Clone, Human, C-HA tag HG14669-CY
HP1 alpha cDNA ORF Clone, Human, N-HA tag HG14669-NY
HP1 alpha cDNA ORF Clone, Human, C-Myc tag HG14669-CM
HP1 alpha cDNA ORF Clone, Human, N-Myc tag HG14669-NM
HP1 alpha qPCR Primer Pairs, Human HP103303
info info
添加购物车成功! 添加购物车失败!