CARS cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52593-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CARS Reagents
CRO Services
Product recommended

All CARS Reagents
CARS cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2247 bp
Description
Full length Clone DNA of Mouse cysteinyl-tRNA synthetase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CARS cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
CA3 cDNA ORF Clone, Mouse
CARS Background Information
Full Name
cysteinyl-tRNA synthetase

CARS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CARS cDNA ORF Clone in Cloning Vector, Rat RG8A1744-U
CARS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1744-ACGLN

CARS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CARS cDNA ORF Clone in Cloning Vector, Mouse MG52593-G
CARS cDNA ORF Clone, Mouse, untagged MG52593-UT
CARS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52593-ACGLN
CARS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52593-ACG
CARS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52593-ANG
CARS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52593-ACR
CARS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52593-ANR
CARS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52593-CF
CARS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52593-NF
CARS cDNA ORF Clone, Mouse, C-His tag MG52593-CH
CARS cDNA ORF Clone, Mouse, N-His tag MG52593-NH
CARS cDNA ORF Clone, Mouse, C-HA tag MG52593-CY
CARS cDNA ORF Clone, Mouse, N-HA tag MG52593-NY
CARS cDNA ORF Clone, Mouse, C-Myc tag MG52593-CM
CARS qPCR Primer Pairs, Mouse MP202464

CARS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CARS cDNA ORF Clone in Cloning Vector, Human HG14312-G
CARS cDNA ORF Clone, Human, untagged HG14312-UT
CARS cDNA ORF Clone, Human, C-GFPSpark® tag HG14312-ACG
CARS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14312-ACGLN
CARS cDNA ORF Clone, Human, N-GFPSpark® tag HG14312-ANG
CARS cDNA ORF Clone, Human, C-OFPSpark® tag HG14312-ACR
CARS cDNA ORF Clone, Human, N-OFPSpark® tag HG14312-ANR
CARS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14312-CF
CARS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14312-NF
CARS cDNA ORF Clone, Human, C-His tag HG14312-CH
CARS cDNA ORF Clone, Human, N-His tag HG14312-NH
CARS cDNA ORF Clone, Human, C-HA tag HG14312-CY
CARS cDNA ORF Clone, Human, N-HA tag HG14312-NY
CARS cDNA ORF Clone, Human, C-Myc tag HG14312-CM
CARS cDNA ORF Clone, Human, N-Myc tag HG14312-NM
CARS qPCR Primer Pairs, Human HP102962
info info
添加购物车成功! 添加购物车失败!