Betacellulin cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50340-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Betacellulin Reagents
CRO Services
Product recommended

All Betacellulin Reagents
Betacellulin cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
534 bp
Description
Full length Clone DNA of Mouse betacellulin, epidermal growth factor family member with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Betacellulin cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
Bcn cDNA ORF Clone, Mouse
Betacellulin Background Information

Betacellulin(BTC) is a member of the epidermal growth factor (EGF) family. These soluble proteins are ligands for one or more of the four receptor tyrosine kinases encoded by the ErbB gene family (ErbB-1/epidermal growth factor receptor (EGFR), neu/ErbB-2/HER2, ErbB-3/HER3 and ErbB-4/HER4). Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. This protein is a ligand for the EGF receptor. BTC is a polymer of about 62-111 amino acid residues. Secondary Structure: 6% helical (1 helices; 3 residues)36% beta sheet (5 strands; 18 residues). BTC was originally identified as a growth-promoting factor in mouse pancreatic β-cell carcinoma cell line and has since been identified in humans. It plays a role in the growth and development of the neonate and/or mammary gland function. Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.

Full Name
betacellulin
References
  • Shing Y, et al. (1993) Betacellulin: a mitogen from pancreatic beta cell tumors. Science . 259(5101): 1604-7.
  • Riese DJ, et al. (1996) Betacellulin activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta. Oncogene. 12(2): 345-53.
  • Bastian SE, et al. (2001) Measurement of betacellulin levels in bovine serum, colostrum and milk. J Endocrinol . 168: 203-12.
  • Betacellulin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Betacellulin cDNA ORF Clone in Cloning Vector, Rhesus CG90033-G
    Betacellulin cDNA ORF Clone, Rhesus, untagged CG90033-UT
    Betacellulin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90033-ACGLN
    Betacellulin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90033-ACG
    Betacellulin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90033-ACR
    Betacellulin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90033-CF
    Betacellulin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90033-NF
    Betacellulin cDNA ORF Clone, Rhesus, C-His tag CG90033-CH
    Betacellulin cDNA ORF Clone, Rhesus, N-His tag CG90033-NH
    Betacellulin cDNA ORF Clone, Rhesus, C-HA tag CG90033-CY
    Betacellulin cDNA ORF Clone, Rhesus, N-HA tag CG90033-NY
    Betacellulin cDNA ORF Clone, Rhesus, C-Myc tag CG90033-CM
    Betacellulin cDNA ORF Clone, Rhesus, N-Myc tag CG90033-NM

    Betacellulin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Betacellulin cDNA ORF Clone in Cloning Vector, Mouse MG50340-M
    Betacellulin cDNA ORF Clone, Mouse, untagged MG50340-UT
    Betacellulin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50340-ACG
    Betacellulin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50340-ACGLN
    Betacellulin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50340-ACR
    Betacellulin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50340-CF
    Betacellulin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50340-NF
    Betacellulin cDNA ORF Clone, Mouse, C-His tag MG50340-CH
    Betacellulin cDNA ORF Clone, Mouse, N-His tag MG50340-NH
    Betacellulin cDNA ORF Clone, Mouse, C-HA tag MG50340-CY
    Betacellulin cDNA ORF Clone, Mouse, N-HA tag MG50340-NY
    Betacellulin cDNA ORF Clone, Mouse, N-Myc tag MG50340-NM
    Betacellulin qPCR Primer Pairs, Mouse MP200363

    Betacellulin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Betacellulin cDNA ORF Clone in Cloning Vector, Human HG12192-G
    Betacellulin cDNA ORF Clone, Human, untagged HG12192-UT
    Betacellulin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12192-ACGLN
    Betacellulin cDNA ORF Clone, Human, C-GFPSpark® tag HG12192-ACG
    Betacellulin cDNA ORF Clone, Human, C-OFPSpark® tag HG12192-ACR
    Betacellulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12192-G-F
    Betacellulin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12192-CF
    Betacellulin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12192-NF
    Betacellulin cDNA ORF Clone, Human, C-His tag HG12192-CH
    Betacellulin cDNA ORF Clone, Human, N-His tag HG12192-NH
    Betacellulin cDNA ORF Clone, Human, C-HA tag HG12192-CY
    Betacellulin cDNA ORF Clone, Human, N-HA tag HG12192-NY
    Betacellulin cDNA ORF Clone, Human, C-Myc tag HG12192-CM
    Betacellulin cDNA ORF Clone, Human, N-Myc tag HG12192-NM
    Betacellulin qPCR Primer Pairs, Human HP101822
    info info
    添加购物车成功! 添加购物车失败!