BOD1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG51981-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BOD1 Reagents
CRO Services
Product recommended

All BOD1 Reagents
BOD1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
522 bp
Description
Full length Clone DNA of Mouse biorientation of chromosomes in cell division 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BOD1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2310022M17Rik cDNA ORF Clone, Mouse;BOD2.1 cDNA ORF Clone, Mouse;Fam44b cDNA ORF Clone, Mouse
BOD1 Background Information
Full Name
biorientation of chromosomes in cell division 1

BOD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BOD1 cDNA ORF Clone in Cloning Vector, Mouse MG51981-G
BOD1 cDNA ORF Clone, Mouse, untagged MG51981-UT
BOD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51981-ACG
BOD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51981-ACGLN
BOD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51981-ANG
BOD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51981-ACR
BOD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51981-ANR
BOD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51981-CF
BOD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51981-NF
BOD1 cDNA ORF Clone, Mouse, C-His tag MG51981-CH
BOD1 cDNA ORF Clone, Mouse, C-HA tag MG51981-CY
BOD1 cDNA ORF Clone, Mouse, N-HA tag MG51981-NY
BOD1 cDNA ORF Clone, Mouse, C-Myc tag MG51981-CM
BOD1 cDNA ORF Clone, Mouse, N-Myc tag MG51981-NM
BOD1 qPCR Primer Pairs, Mouse MP201854

BOD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BOD1 cDNA ORF Clone in Cloning Vector, Human HG19663-U
BOD1 cDNA ORF Clone, Human, untagged HG19663-UT
BOD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG19663-ACG
BOD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19663-ACGLN
BOD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG19663-ANG
BOD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG19663-ACR
BOD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG19663-ANR
BOD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19663-CF
BOD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19663-NF
BOD1 cDNA ORF Clone, Human, C-His tag HG19663-CH
BOD1 cDNA ORF Clone, Human, N-His tag HG19663-NH
BOD1 cDNA ORF Clone, Human, C-HA tag HG19663-CY
BOD1 cDNA ORF Clone, Human, N-HA tag HG19663-NY
BOD1 cDNA ORF Clone, Human, C-Myc tag HG19663-CM
BOD1 cDNA ORF Clone, Human, N-Myc tag HG19663-NM
info info
添加购物车成功! 添加购物车失败!