Butyrylcholinesterase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50418-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Butyrylcholinesterase Reagents
CRO Services
Product recommended

All Butyrylcholinesterase Reagents
Butyrylcholinesterase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1812 bp
Description
Full length Clone DNA of Mouse butyrylcholinesterase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Butyrylcholinesterase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
C730038G20Rik cDNA ORF Clone, Mouse
Butyrylcholinesterase Background Information

Butyrylcholinesterase (BCHE), also known as cholinesterase or BuChE, is an enzyme defined as "pseudo" or "non-neuronal" cholinesterase. Butyrylcholinesterase (BCHE) is widely distributed in the nervous system as well as blood plasma. It is constitutively similar to the neuronal acetylcholinesterase, and is a non-specific cholinesterase which hydrolyses many different choline esters. Butyrylcholinesterase (BCHE) is a glycoprotein of 4 identical subunits, that were arranged as a dimer of dimers with each dimer composed of two identical subunits joined by interchain disulfide bonds. Butyrylcholinesterase (BCHE) behaves principally similar to the true enzyme and thus can play a similar role in nerve conduction, although it participates probably only in relatively slow conductive processes and could be involved in other nervous system functions and in neurodegenerative diseases. It can hydrolyze toxic esters such as cocaine or scavenge organophosphorus pesticides and nerve agents. Purified human serum cholinesterase combines in its active surface an anionic and an esteratic site, similar to true cholinesterase. It has been demonstrated that butyrylcholinesterase (BCHE) may have a greater role in cholinergic transmission than previously surmised, making BChE inhibition an important therapeutic goal in Alzheimer's disease.

Full Name
butyrylcholinesterase
References
  • Lockridge O. (1988) Structure of human serum cholinesterase. Bio Essays. 9(4):125-8.
  • Mesulam M, et al. (2002) Widely Spread Butyrylcholinesterase Can Hydrolyze Acetylcholine in the Normal and Alzheimer Brain. Neurobiology of Disease. 9(1): 88-93.
  • Nicolet Y, et al. (2003) Crystal Structure of Human Butyrylcholinesterase and of Its Complexes with Substrate and Products. The Journal of Biological Chemistry. 278: 41141-7.
  • Butyrylcholinesterase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Butyrylcholinesterase cDNA ORF Clone in Cloning Vector, Mouse MG50418-M
    Butyrylcholinesterase cDNA ORF Clone, Mouse, untagged MG50418-UT
    Butyrylcholinesterase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50418-ACG
    Butyrylcholinesterase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50418-ACGLN
    Butyrylcholinesterase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50418-ACR
    Butyrylcholinesterase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50418-NF
    Butyrylcholinesterase cDNA ORF Clone, Mouse, C-His tag MG50418-CH
    Butyrylcholinesterase cDNA ORF Clone, Mouse, N-His tag MG50418-NH
    Butyrylcholinesterase cDNA ORF Clone, Mouse, C-HA tag MG50418-CY
    Butyrylcholinesterase cDNA ORF Clone, Mouse, N-HA tag MG50418-NY
    Butyrylcholinesterase cDNA ORF Clone, Mouse, C-Myc tag MG50418-CM
    Butyrylcholinesterase cDNA ORF Clone, Mouse, N-Myc tag MG50418-NM
    Butyrylcholinesterase qPCR Primer Pairs, Mouse MP200087

    Butyrylcholinesterase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Butyrylcholinesterase cDNA ORF Clone in Cloning Vector, Human HG12010-G
    Butyrylcholinesterase cDNA ORF Clone, Human, untagged HG12010-UT
    Butyrylcholinesterase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12010-ACGLN
    Butyrylcholinesterase cDNA ORF Clone, Human, C-GFPSpark® tag HG12010-ACG
    Butyrylcholinesterase cDNA ORF Clone, Human, C-OFPSpark® tag HG12010-ACR
    Butyrylcholinesterase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12010-CF
    Butyrylcholinesterase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12010-G-F
    Butyrylcholinesterase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12010-NF
    Butyrylcholinesterase cDNA ORF Clone, Human, C-His tag HG12010-CH
    Butyrylcholinesterase cDNA ORF Clone, Human, N-His tag HG12010-NH
    Butyrylcholinesterase cDNA ORF Clone, Human, C-HA tag HG12010-CY
    Butyrylcholinesterase cDNA ORF Clone, Human, N-HA tag HG12010-NY
    Butyrylcholinesterase cDNA ORF Clone, Human, C-Myc tag HG12010-CM
    Butyrylcholinesterase cDNA ORF Clone, Human, N-Myc tag HG12010-NM
    Butyrylcholinesterase qPCR Primer Pairs, Human HP101547
    info info
    添加购物车成功! 添加购物车失败!