BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52769-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All BABAM1/HSPC142 Reagents
CRO Services
Product recommended

All BABAM1/HSPC142 Reagents
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1002 bp
Description
Full length Clone DNA of Mouse BRISC and BRCA1 A complex member 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
5430437P03Rik cDNA ORF Clone, Mouse;Merit40 cDNA ORF Clone, Mouse
BABAM1/HSPC142 Background Information
Full Name
BRISC and BRCA1 A complex member 1

BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
BABAM1/HSPC142 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90485-G
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, untagged CG90485-UT
BABAM1/HSPC142 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90485-ACGLN
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90485-ACG
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90485-ANG
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90485-ACR
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90485-ANR
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90485-CF
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90485-NF
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-His tag CG90485-CH
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-His tag CG90485-NH
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-HA tag CG90485-CY
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-HA tag CG90485-NY
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90485-CM
BABAM1/HSPC142 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90485-NM

BABAM1/HSPC142 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BABAM1/HSPC142 cDNA ORF Clone in Cloning Vector, Mouse MG52769-G
BABAM1/HSPC142 cDNA ORF Clone, Mouse, untagged MG52769-UT
BABAM1/HSPC142 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52769-ACGLN
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52769-ACG
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52769-ACR
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52769-CF
BABAM1/HSPC142 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52769-NF
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-His tag MG52769-CH
BABAM1/HSPC142 cDNA ORF Clone, Mouse, N-His tag MG52769-NH
BABAM1/HSPC142 cDNA ORF Clone, Mouse, C-HA tag MG52769-CY
BABAM1/HSPC142 cDNA ORF Clone, Mouse, N-HA tag MG52769-NY
BABAM1/HSPC142 cDNA ORF Clone, Mouse, N-Myc tag MG52769-NM

BABAM1/HSPC142 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BABAM1/HSPC142 cDNA ORF Clone in Cloning Vector, Human HG20451-U
BABAM1/HSPC142 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20451-ACGLN
info info
添加购物车成功! 添加购物车失败!