ICOS ligand cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50190-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ICOS ligand Reagents

CRO Services

Product recommended


All ICOS ligand Reagents

ICOS ligand cDNA ORF Clone, Mouse, N-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
969 bp
Description
Full length Clone DNA of Mouse icos ligand with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ICOS ligand Background Information

Inducible co-stimulator ligand (ICOSL), also known as B7-H2, is a member of the B7 family of co-stimulatory molecules related to B7-1 and B7-2. It is a transmembrane glycoprotein with extracellular IgV and IgC domains, and binds to ICOS on activated T cells, thus delivers a positive costimulatory signal for optimal T cell function. The structural features of ICOSL are crucial for its costimulatory function. Present study shows that ICOSL displays a marked oligomerization potential, resembling more like B7-1 than B7-2. B7-H2-dependent signaling may play an active role in a proliferative response rather than in cytokine and chemokine production. The CD28/B7 and ICOS/B7-H2 pathways are both critical for costimulating T cell immune responses. Deficiency in either pathway results in defective T cell activation, cytokine production and germinal center formation.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
inducible T-cell co-stimulator ligand
References
  • Flesch IE. (2002) Inducible costimulator-ligand (ICOS-L). J Biol Regul Homeost Agents. 16(3): 217-9.
  • Kajiwara K, et al. (2009) Expression and function of the inducible costimulator ligand B7-H2 in human airway smooth muscle cells. Allergol Int. 58(4): 573-83.
  • Wong SC, et al. (2009) Functional hierarchy and relative contribution of the CD28/B7 and ICOS/B7-H2 costimulatory pathways to T cell-mediated delayed-type hypersensitivity. Cell Immunol. 256(1-2): 64-71.
  • ICOS ligand cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    ICOS ligand cDNA ORF Clone in Cloning Vector, Cynomolgus CG90800-G

    ICOS ligand cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ICOS ligand cDNA ORF Clone in Cloning Vector, Rat RG81346-G

    ICOS ligand cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ICOS ligand cDNA ORF Clone in Cloning Vector, Mouse MG50190-M
    ICOS ligand cDNA ORF Clone, Mouse, untagged MG50190-UT
    ICOS ligand cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50190-ACG
    ICOS ligand Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50190-ACGLN
    ICOS ligand cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50190-ACR
    ICOS ligand cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50190-CF
    ICOS ligand cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50190-NF
    ICOS ligand cDNA ORF Clone, Mouse, C-His tag MG50190-CH
    ICOS ligand cDNA ORF Clone, Mouse, N-His tag MG50190-NH
    ICOS ligand cDNA ORF Clone, Mouse, C-HA tag MG50190-CY
    ICOS ligand cDNA ORF Clone, Mouse, N-HA tag MG50190-NY
    ICOS ligand cDNA ORF Clone, Mouse, C-Myc tag MG50190-CM
    ICOS ligand qPCR Primer Pairs, Mouse MP200220

    ICOS ligand cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ICOS ligand cDNA ORF Clone, Human, untagged HG29774-UT
    ICOS ligand cDNA ORF Clone, Human, untagged HG11559-UT
    ICOS ligand Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11559-ACGLN
    ICOS ligand cDNA ORF Clone, Human, C-GFPSpark® tag HG11559-ACG
    ICOS ligand cDNA ORF Clone, Human, C-OFPSpark® tag HG11559-ACR
    ICOS ligand cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11559-CF
    ICOS ligand cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11559-NF
    ICOS ligand cDNA ORF Clone, Human, C-His tag HG11559-CH
    ICOS ligand cDNA ORF Clone, Human, N-His tag HG11559-NH
    ICOS ligand cDNA ORF Clone, Human, C-HA tag HG11559-CY
    ICOS ligand cDNA ORF Clone, Human, N-HA tag HG11559-NY
    ICOS ligand cDNA ORF Clone, Human, C-Myc tag HG11559-CM
    ICOS ligand cDNA ORF Clone, Human, N-Myc tag HG11559-NM
    ICOS ligand qPCR Primer Pairs, Human HP101424
    info info
    添加购物车成功! 添加购物车失败!