ATP5J2 cDNA ORF Clone, Mouse, untagged

Cat: MG51348-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATP5J2 Reagents
CRO Services
Product recommended

All ATP5J2 Reagents
ATP5J2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
267 bp
Description
Full length Clone DNA of Mouse ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5J2 cDNA ORF Clone, Mouse, untagged Alternative Names
1110019H14Rik cDNA ORF Clone, Mouse
ATP5J2 Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2

ATP5J2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5J2 cDNA ORF Clone in Cloning Vector, Mouse MG51348-U
ATP5J2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51348-ACGLN
ATP5J2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51348-ACG
ATP5J2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51348-ANG
ATP5J2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51348-ACR
ATP5J2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51348-ANR
ATP5J2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51348-CF
ATP5J2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51348-NF
ATP5J2 cDNA ORF Clone, Mouse, C-His tag MG51348-CH
ATP5J2 cDNA ORF Clone, Mouse, N-His tag MG51348-NH
ATP5J2 cDNA ORF Clone, Mouse, C-HA tag MG51348-CY
ATP5J2 cDNA ORF Clone, Mouse, N-HA tag MG51348-NY
ATP5J2 cDNA ORF Clone, Mouse, C-Myc tag MG51348-CM
ATP5J2 cDNA ORF Clone, Mouse, N-Myc tag MG51348-NM
ATP5J2 qPCR Primer Pairs, Mouse MP201225

ATP5J2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5J2 cDNA ORF Clone in Cloning Vector, Human HG16192-G
ATP5J2 cDNA ORF Clone, Human, untagged HG16192-UT
ATP5J2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16192-ACGLN
ATP5J2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16192-ACG
ATP5J2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16192-ANG
ATP5J2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16192-ACR
ATP5J2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16192-ANR
ATP5J2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16192-CF
ATP5J2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16192-NF
ATP5J2 cDNA ORF Clone, Human, C-His tag HG16192-CH
ATP5J2 cDNA ORF Clone, Human, N-His tag HG16192-NH
ATP5J2 cDNA ORF Clone, Human, C-HA tag HG16192-CY
ATP5J2 cDNA ORF Clone, Human, N-HA tag HG16192-NY
ATP5J2 cDNA ORF Clone, Human, C-Myc tag HG16192-CM
ATP5J2 cDNA ORF Clone, Human, N-Myc tag HG16192-NM
ATP5J2 qPCR Primer Pairs, Human HP104960
info info
添加购物车成功! 添加购物车失败!