ARPC2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50745-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ARPC2 Reagents
CRO Services
Product recommended

All ARPC2 Reagents
ARPC2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
903 bp
Description
Full length Clone DNA of Mouse actin related protein 2/3 complex, subunit 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARPC2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2210023N03Rik cDNA ORF Clone, Mouse;34kDa cDNA ORF Clone, Mouse;p34-Arc cDNA ORF Clone, Mouse
ARPC2 Background Information
Full Name
actin related protein 2/3 complex, subunit 2, 34kDa

ARPC2 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
ARPC2 cDNA ORF Clone in Cloning Vector, Rabbit TG65086-G
ARPC2 cDNA ORF Clone, Rabbit, untagged TG65086-UT
ARPC2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65086-ACG
ARPC2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65086-ANG
ARPC2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65086-ACR
ARPC2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65086-ANR
ARPC2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65086-CF
ARPC2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65086-NF
ARPC2 cDNA ORF Clone, Rabbit, C-His tag TG65086-CH
ARPC2 cDNA ORF Clone, Rabbit, N-His tag TG65086-NH
ARPC2 cDNA ORF Clone, Rabbit, C-HA tag TG65086-CY
ARPC2 cDNA ORF Clone, Rabbit, N-HA tag TG65086-NY
ARPC2 cDNA ORF Clone, Rabbit, C-Myc tag TG65086-CM
ARPC2 cDNA ORF Clone, Rabbit, N-Myc tag TG65086-NM

ARPC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ARPC2 cDNA ORF Clone in Cloning Vector, Rat RG80946-U
ARPC2 cDNA ORF Clone, Rat, untagged RG80946-UT
ARPC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80946-ACG
ARPC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80946-ACGLN
ARPC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80946-ANG
ARPC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80946-ACR
ARPC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80946-ANR
ARPC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80946-CF
ARPC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80946-NF
ARPC2 cDNA ORF Clone, Rat, C-His tag RG80946-CH
ARPC2 cDNA ORF Clone, Rat, N-His tag RG80946-NH
ARPC2 cDNA ORF Clone, Rat, C-HA tag RG80946-CY
ARPC2 cDNA ORF Clone, Rat, N-HA tag RG80946-NY
ARPC2 cDNA ORF Clone, Rat, C-Myc tag RG80946-CM
ARPC2 cDNA ORF Clone, Rat, N-Myc tag RG80946-NM
ARPC2 qPCR Primer Pairs, Rat RP300910

ARPC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ARPC2 cDNA ORF Clone in Cloning Vector, Mouse MG50745-G
ARPC2 cDNA ORF Clone, Mouse, untagged MG50745-UT
ARPC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50745-ACGLN
ARPC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50745-ACG
ARPC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50745-ANG
ARPC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50745-ACR
ARPC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50745-ANR
ARPC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50745-CF
ARPC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50745-NF
ARPC2 cDNA ORF Clone, Mouse, C-His tag MG50745-CH
ARPC2 cDNA ORF Clone, Mouse, C-HA tag MG50745-CY
ARPC2 cDNA ORF Clone, Mouse, N-HA tag MG50745-NY
ARPC2 cDNA ORF Clone, Mouse, C-Myc tag MG50745-CM
ARPC2 cDNA ORF Clone, Mouse, N-Myc tag MG50745-NM
ARPC2 qPCR Primer Pairs, Mouse MP200720

ARPC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ARPC2 cDNA ORF Clone in Cloning Vector, Human HG11098-M
ARPC2 cDNA ORF Clone, Human, untagged HG11098-UT
ARPC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11098-ACG
ARPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11098-ACGLN
ARPC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11098-ANG
ARPC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11098-ACR
ARPC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11098-ANR
ARPC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11098-CF
ARPC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11098-NF
ARPC2 cDNA ORF Clone, Human, C-His tag HG11098-CH
ARPC2 cDNA ORF Clone, Human, N-His tag HG11098-NH
ARPC2 cDNA ORF Clone, Human, C-HA tag HG11098-CY
ARPC2 cDNA ORF Clone, Human, N-HA tag HG11098-NY
ARPC2 cDNA ORF Clone, Human, C-Myc tag HG11098-CM
ARPC2 cDNA ORF Clone, Human, N-Myc tag HG11098-NM
ARPC2 qPCR Primer Pairs, Human HP101013
info info
添加购物车成功! 添加购物车失败!