Annexin VI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG52219-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Annexin VI Reagents
CRO Services
Product recommended

All Annexin VI Reagents
Annexin VI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2022 bp
Description
Full length Clone DNA of Mouse annexin A6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Annexin VI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Anx6 cDNA ORF Clone, Mouse;AnxVI cDNA ORF Clone, Mouse;AW107198 cDNA ORF Clone, Mouse;Cabm cDNA ORF Clone, Mouse;Camb cDNA ORF Clone, Mouse
Annexin VI Background Information

Annexin A6, also known as ANXA6 or ANXAⅥ, belongs to a family of Ca2+-dependent membrane and phospholipid binding proteins. Members of this family have been implicated in membrane-related events along exocytotic and endocytotic pathways. Annexin 6 is phosphorylated in vivo associated with cell growth. Annexin 6 was not phosphorylated in quiescent cells, but was phosphorylated on serine and to a lesser extent threonine, several hours following cell stimulation. Experiment has revealed the presence of annexin A6 on the cell surface of variety cells as putative receptors and / or binding proteins for chondroitin sulfate proteoglycans, helping cells to bind with this extracellular matrix glycosaminoglycan chondroitin sulfate which is related to the cell-substratum adhesion. A post-tranlational modification other than direct protein phosphorylation may influence the activity of annexin6 and provide evidence linking cell growth with regulation of annexin 6 function. 

Full Name
annexin A6
References
  • Takagi H, et al. (2002) Annexin 6 is a putative cell surface receptor for chondroitin sulfate chains. J Cell Sci. 115 (16): 3309-18.
  • Moss SE, et al. (1992) A growth-dependent post-translational modification of annexin VI. Biochim Biophys Acta. 1160 (1): 120-6.
  • Song G, et al. (1998) Altered cardiac annexin mRNA and protein levels in the left ventricle of patients with end-stage heart failure. J Mol Cell Cardio. 30 (3): 443-51.
  • Annexin VI cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Annexin VI cDNA ORF Clone in Cloning Vector, Mouse MG52219-G
    Annexin VI cDNA ORF Clone, Mouse, untagged MG52219-UT
    Annexin VI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52219-ACG
    Annexin VI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52219-ACGLN
    Annexin VI cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52219-ANG
    Annexin VI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52219-ACR
    Annexin VI cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52219-ANR
    Annexin VI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52219-NF
    Annexin VI cDNA ORF Clone, Mouse, C-His tag MG52219-CH
    Annexin VI cDNA ORF Clone, Mouse, N-His tag MG52219-NH
    Annexin VI cDNA ORF Clone, Mouse, C-HA tag MG52219-CY
    Annexin VI cDNA ORF Clone, Mouse, N-HA tag MG52219-NY
    Annexin VI cDNA ORF Clone, Mouse, C-Myc tag MG52219-CM
    Annexin VI cDNA ORF Clone, Mouse, N-Myc tag MG52219-NM
    Annexin VI qPCR Primer Pairs, Mouse MP202092

    Annexin VI cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Annexin VI cDNA ORF Clone in Cloning Vector, Human HG11161-U
    Annexin VI cDNA ORF Clone, Human, untagged HG11161-UT
    Annexin VI cDNA ORF Clone, Human, C-GFPSpark® tag HG11161-ACG
    Annexin VI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11161-ACGLN
    Annexin VI cDNA ORF Clone, Human, N-GFPSpark® tag HG11161-ANG
    Annexin VI cDNA ORF Clone, Human, C-OFPSpark® tag HG11161-ACR
    Annexin VI cDNA ORF Clone, Human, N-OFPSpark® tag HG11161-ANR
    Annexin VI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11161-CF
    Annexin VI cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11161-NF
    Annexin VI cDNA ORF Clone, Human, C-His tag HG11161-CH
    Annexin VI cDNA ORF Clone, Human, N-His tag HG11161-NH
    Annexin VI cDNA ORF Clone, Human, C-HA tag HG11161-CY
    Annexin VI cDNA ORF Clone, Human, N-HA tag HG11161-NY
    Annexin VI cDNA ORF Clone, Human, C-Myc tag HG11161-CM
    Annexin VI cDNA ORF Clone, Human, N-Myc tag HG11161-NM
    Annexin VI qPCR Primer Pairs, Human HP101069
    info info
    添加购物车成功! 添加购物车失败!