AGRP cDNA ORF Clone, Mouse, untagged

Cat: MG50276-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All AGRP Reagents
CRO Services
Product recommended

All AGRP Reagents
AGRP cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
396 bp
Description
Full length Clone DNA of Mouse agouti related protein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

AGRP cDNA ORF Clone, Mouse, untagged Alternative Names
Agrt cDNA ORF Clone, Mouse;Art cDNA ORF Clone, Mouse
AGRP Background Information

Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.

Full Name
agouti related neuropeptide
References
  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • AGRP cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    AGRP cDNA ORF Clone in Cloning Vector, Rhesus CG90196-G
    AGRP cDNA ORF Clone, Rhesus, untagged CG90196-UT
    AGRP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90196-ACGLN
    AGRP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90196-ACG
    AGRP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90196-ACR
    AGRP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90196-CF
    AGRP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90196-NF
    AGRP cDNA ORF Clone, Rhesus, C-His tag CG90196-CH
    AGRP cDNA ORF Clone, Rhesus, N-His tag CG90196-NH
    AGRP cDNA ORF Clone, Rhesus, C-HA tag CG90196-CY
    AGRP cDNA ORF Clone, Rhesus, N-HA tag CG90196-NY
    AGRP cDNA ORF Clone, Rhesus, C-Myc tag CG90196-CM
    AGRP cDNA ORF Clone, Rhesus, N-Myc tag CG90196-NM

    AGRP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    AGRP cDNA ORF Clone in Cloning Vector, Mouse MG50276-M
    AGRP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50276-ACGLN
    AGRP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50276-ACG
    AGRP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50276-ACR
    AGRP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50276-CF
    AGRP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50276-NF
    AGRP cDNA ORF Clone, Mouse, C-His tag MG50276-CH
    AGRP cDNA ORF Clone, Mouse, N-His tag MG50276-NH
    AGRP cDNA ORF Clone, Mouse, C-HA tag MG50276-CY
    AGRP cDNA ORF Clone, Mouse, N-HA tag MG50276-NY
    AGRP cDNA ORF Clone, Mouse, C-Myc tag MG50276-CM
    AGRP cDNA ORF Clone, Mouse, N-Myc tag MG50276-NM
    AGRP qPCR Primer Pairs, Mouse MP200300

    AGRP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    AGRP cDNA ORF Clone in Cloning Vector, Human HG10070-M
    AGRP cDNA ORF Clone, Human, untagged HG10070-UT
    AGRP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10070-ACGLN
    AGRP cDNA ORF Clone, Human, C-GFPSpark® tag HG10070-ACG
    AGRP cDNA ORF Clone, Human, C-OFPSpark® tag HG10070-ACR
    AGRP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10070-CF
    AGRP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10070-NF
    AGRP cDNA ORF Clone, Human, C-His tag HG10070-CH
    AGRP cDNA ORF Clone, Human, N-His tag HG10070-NH
    AGRP cDNA ORF Clone, Human, C-HA tag HG10070-CY
    AGRP cDNA ORF Clone, Human, N-HA tag HG10070-NY
    AGRP cDNA ORF Clone, Human, C-Myc tag HG10070-CM
    AGRP cDNA ORF Clone, Human, N-Myc tag HG10070-NM
    AGRP qPCR Primer Pairs, Human HP100156
    info info
    添加购物车成功! 添加购物车失败!