Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51018-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Prostatic Acid Phosphatase Reagents
CRO Services
Product recommended

All Prostatic Acid Phosphatase Reagents
Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 126G/A and 174A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse acid phosphatase, prostate with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.3kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Prostatic Acid Phosphatase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse Prostatic Acid Phosphatase/ACPP Gene Expression validated Image 2255
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
5'-NT cDNA ORF Clone, Mouse;9.104100899-104272570.1 cDNA ORF Clone, Mouse;A030005E02Rik cDNA ORF Clone, Mouse;FRAP cDNA ORF Clone, Mouse;Lap cDNA ORF Clone, Mouse;PAP cDNA ORF Clone, Mouse;Ppal cDNA ORF Clone, Mouse
Prostatic Acid Phosphatase Background Information

Prostatic acid phosphatase (PAP, or ACPP), also known as prostatic specific acid phosphatase (PSAP), is an enzyme produced by the prostate. As a non-specific phosphomonoesterase, Prostatic acid phosphatase synthetized and secreted into seminal plasma under androgenic control. The enzyme is a dimer of molecular weight around 100 kDa. Prostatic acid phosphatase is a clinically important protein for its relevance as a biomarker of prostate carcinoma. Furthermore, it has a potential role in fertilization. The major action of PAP is to dephosphorylate macromolecules with the help of catalytic residues (His(12) and Asp(258)) that are located in the cleft between two domains. Cellular prostatic acid phosphatase (cPAcP), an authentic tyrosine phosphatase, is proposed to function as a negative growth regulator of prostate cancer (PCa) cells in part through its dephosphorylation of ErbB-2. cPAcP functions as a neutral protein tyrosine phosphatase (PTP) in prostate cancer cells and dephosphorylates HER-2/ErbB-2/Neu (HER-2: human epidermal growth factor receptor-2) at the phosphotyrosine (p-Tyr) residues. Injection of the secretory isoform of PAP has potent antinociceptive effects in mouse models of chronic pain. This enzyme exhibits ecto-5'-nucleotidase activity, is widely distributed, and implicated in the formation of chronic pain. Additionally, PAP could be a target molecule in specific immunotherapy for patients with nonprostate adenocarcinomas including colon and gastric cancers.

Full Name
acid phosphatase, prostate
References
  • Hassan MI, et al. (2010) Structural and functional analysis of human prostatic acid phosphatase. Expert Rev Anticancer Ther. 10(7): 1055-68.
  • Chuang TD, et al. (2010) Human prostatic acid phosphatase, an authentic tyrosine phosphatase, dephosphorylates ErbB-2 and regulates prostate cancer cell growth. J Biol Chem. 285(31): 23598-606.
  • Larsen RS, et al. (2009) A high throughput assay to identify small molecule modulators of prostatic acid phosphatase. Curr Chem Genomics. 3: 42-9.
  • Zimmermann H. (2009) Prostatic acid phosphatase, a neglected ectonucleotidase. Purinergic Signal. 5(3): 273-5.
  • Wang Y, et al. (2005) Prostatic acid phosphatase as a target molecule in specific immunotherapy for patients with nonprostate adenocarcinoma. J Immunother. 28(6): 535-41.
  • Veeramani S, et al. (2005) Cellular prostatic acid phosphatase: a protein tyrosine phosphatase involved in androgen-independent proliferation of prostate cancer. Endocr Relat Cancer. 12(4): 805-22.
  • Ostrowski WS, et al. (1994) Human prostatic acid phosphatase: selected properties and practical applications. Clin Chim Acta. 226(2): 121-9.
  • Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Prostatic Acid Phosphatase cDNA ORF Clone in Cloning Vector, Mouse MG51018-G
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, untagged MG51018-UT
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51018-ACG
    Prostatic Acid Phosphatase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51018-ACGLN
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51018-ACR
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51018-NF
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-His tag MG51018-CH
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, N-His tag MG51018-NH
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-HA tag MG51018-CY
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, N-HA tag MG51018-NY
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, C-Myc tag MG51018-CM
    Prostatic Acid Phosphatase cDNA ORF Clone, Mouse, N-Myc tag MG51018-NM
    Prostatic Acid Phosphatase qPCR Primer Pairs, Mouse MP200977

    Prostatic Acid Phosphatase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Prostatic Acid Phosphatase cDNA ORF Clone in Cloning Vector, Human HG10959-M
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, untagged HG10959-UT
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-GFPSpark® tag HG10959-ACG
    Prostatic Acid Phosphatase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10959-ACGLN
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-OFPSpark® tag HG10959-ACR
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10959-CF
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10959-NF
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-His tag HG10959-CH
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, N-His tag HG10959-NH
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-HA tag HG10959-CY
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, N-HA tag HG10959-NY
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, C-Myc tag HG10959-CM
    Prostatic Acid Phosphatase cDNA ORF Clone, Human, N-Myc tag HG10959-NM
    Prostatic Acid Phosphatase qPCR Primer Pairs, Human HP100835
    info info
    添加购物车成功! 添加购物车失败!