Aconitase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51015-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Aconitase 2 Reagents
CRO Services
Product recommended

All Aconitase 2 Reagents
Aconitase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Mouse aconitase 2, mitochondrial with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aconitase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Aco-2 cDNA ORF Clone, Mouse;Aco3 cDNA ORF Clone, Mouse;D10Wsu183e cDNA ORF Clone, Mouse
Aconitase 2 Background Information
Full Name
aconitase 2, mitochondrial
References
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Aconitase 2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Rhesus CG90615-G
    Aconitase 2 cDNA ORF Clone, Rhesus, untagged CG90615-UT
    Aconitase 2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90615-ACGLN
    Aconitase 2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90615-ACG
    Aconitase 2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90615-ANG
    Aconitase 2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90615-ACR
    Aconitase 2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90615-ANR
    Aconitase 2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90615-CF
    Aconitase 2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90615-NF
    Aconitase 2 cDNA ORF Clone, Rhesus, C-His tag CG90615-CH
    Aconitase 2 cDNA ORF Clone, Rhesus, N-His tag CG90615-NH
    Aconitase 2 cDNA ORF Clone, Rhesus, C-HA tag CG90615-CY
    Aconitase 2 cDNA ORF Clone, Rhesus, N-HA tag CG90615-NY
    Aconitase 2 cDNA ORF Clone, Rhesus, C-Myc tag CG90615-CM
    Aconitase 2 cDNA ORF Clone, Rhesus, N-Myc tag CG90615-NM

    Aconitase 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Rat RG80908-U
    Aconitase 2 cDNA ORF Clone, Rat, untagged RG80908-UT
    Aconitase 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80908-ACGLN
    Aconitase 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80908-ACG
    Aconitase 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80908-ANG
    Aconitase 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80908-ACR
    Aconitase 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80908-ANR
    Aconitase 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80908-CF
    Aconitase 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80908-NF
    Aconitase 2 cDNA ORF Clone, Rat, C-His tag RG80908-CH
    Aconitase 2 cDNA ORF Clone, Rat, N-His tag RG80908-NH
    Aconitase 2 cDNA ORF Clone, Rat, C-HA tag RG80908-CY
    Aconitase 2 cDNA ORF Clone, Rat, N-HA tag RG80908-NY
    Aconitase 2 cDNA ORF Clone, Rat, C-Myc tag RG80908-CM
    Aconitase 2 cDNA ORF Clone, Rat, N-Myc tag RG80908-NM
    Aconitase 2 qPCR Primer Pairs, Rat RP300872

    Aconitase 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Mouse MG51015-G
    Aconitase 2 cDNA ORF Clone, Mouse, untagged MG51015-UT
    Aconitase 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51015-ACG
    Aconitase 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51015-ACGLN
    Aconitase 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51015-ANG
    Aconitase 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51015-ACR
    Aconitase 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51015-ANR
    Aconitase 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51015-NF
    Aconitase 2 cDNA ORF Clone, Mouse, C-His tag MG51015-CH
    Aconitase 2 cDNA ORF Clone, Mouse, N-His tag MG51015-NH
    Aconitase 2 cDNA ORF Clone, Mouse, C-HA tag MG51015-CY
    Aconitase 2 cDNA ORF Clone, Mouse, N-HA tag MG51015-NY
    Aconitase 2 cDNA ORF Clone, Mouse, C-Myc tag MG51015-CM
    Aconitase 2 cDNA ORF Clone, Mouse, N-Myc tag MG51015-NM
    Aconitase 2 qPCR Primer Pairs, Mouse MP200974

    Aconitase 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Human HG10958-M
    Aconitase 2 cDNA ORF Clone, Human, untagged HG10958-UT
    Aconitase 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10958-ACG
    Aconitase 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10958-ACGLN
    Aconitase 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10958-ANG
    Aconitase 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10958-ACR
    Aconitase 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10958-ANR
    Aconitase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10958-CF
    Aconitase 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10958-NF
    Aconitase 2 cDNA ORF Clone, Human, C-His tag HG10958-CH
    Aconitase 2 cDNA ORF Clone, Human, N-His tag HG10958-NH
    Aconitase 2 cDNA ORF Clone, Human, C-HA tag HG10958-CY
    Aconitase 2 cDNA ORF Clone, Human, N-HA tag HG10958-NY
    Aconitase 2 cDNA ORF Clone, Human, C-Myc tag HG10958-CM
    Aconitase 2 cDNA ORF Clone, Human, N-Myc tag HG10958-NM
    Aconitase 2 qPCR Primer Pairs, Human HP100834
    info info
    添加购物车成功! 添加购物车失败!