methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10245-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All methionyl aminopeptidase 2 Reagents
CRO Services

All methionyl aminopeptidase 2 Reagents
methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1437 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human methionyl aminopeptidase 2 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.49kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
methionyl aminopeptidase 2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
MAP2 cDNA ORF Clone, Human;MNPEP cDNA ORF Clone, Human;p67 cDNA ORF Clone, Human;p67eIF2 cDNA ORF Clone, Human
methionyl aminopeptidase 2 Background Information

METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

Full Name
methionyl aminopeptidase 2
Research Areas
References
  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • methionyl aminopeptidase 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    methionyl aminopeptidase 2 cDNA ORF Clone in Cloning Vector, Rat RG81187-U
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, untagged RG81187-UT
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81187-ACG
    methionyl aminopeptidase 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81187-ACGLN
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81187-ANG
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81187-ACR
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81187-ANR
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81187-CF
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81187-NF
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-His tag RG81187-CH
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-His tag RG81187-NH
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-HA tag RG81187-CY
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-HA tag RG81187-NY
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, C-Myc tag RG81187-CM
    methionyl aminopeptidase 2 cDNA ORF Clone, Rat, N-Myc tag RG81187-NM
    methionyl aminopeptidase 2 qPCR Primer Pairs, Rat RP301143

    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    methionyl aminopeptidase 2 cDNA ORF Clone in Cloning Vector, Mouse MG50528-M
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, untagged MG50528-UT
    methionyl aminopeptidase 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50528-ACGLN
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50528-ACG
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50528-ANG
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50528-ACR
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50528-ANR
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50528-CF
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50528-NF
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-His tag MG50528-CH
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-His tag MG50528-NH
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-HA tag MG50528-CY
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-HA tag MG50528-NY
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, C-Myc tag MG50528-CM
    methionyl aminopeptidase 2 cDNA ORF Clone, Mouse, N-Myc tag MG50528-NM
    methionyl aminopeptidase 2 qPCR Primer Pairs, Mouse MP200520

    methionyl aminopeptidase 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    methionyl aminopeptidase 2 cDNA ORF Clone in Cloning Vector, Human HG10245-M
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, untagged HG10245-UT
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10245-ACG
    methionyl aminopeptidase 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10245-ACGLN
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10245-ANG
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10245-ACR
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10245-ANR
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10245-CF
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10245-NF
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-His tag HG10245-CH
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-His tag HG10245-NH
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-HA tag HG10245-CY
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-HA tag HG10245-NY
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, C-Myc tag HG10245-CM
    methionyl aminopeptidase 2 cDNA ORF Clone, Human, N-Myc tag HG10245-NM
    methionyl aminopeptidase 2 qPCR Primer Pairs, Human HP100295
    info info
    添加购物车成功! 添加购物车失败!