Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag

Cat: VG40045-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Neuraminidase / NA Reagents
CRO Services
Product recommended

All Neuraminidase / NA Reagents
Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag General Information
Gene
Species
H5N1
RefSeq ORF Size
1350 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACJ53852.1.
Description
Full length Clone DNA of Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag Alternative Names
NA cDNA ORF Clone, H5N1
Neuraminidase / NA Background Information

Neuraminidases are enzymes that cleave sialic acid groups from glycoproteins. Influenza neuraminidase is a type of neuraminidase found on the surface of influenza viruses that enables the virus to be released from the host cell.

Influenza neuraminidase is composed of four identical subunits arranged in a square. It is normally attached to the virus surface through a long protein stalk. The active sites are in a deep depression on the upper surface. They bind to polysaccharide chains and clip off the sugars at the end. The surface of neuraminidase is decorated with several polysaccharide chains that are similar to the polysaccharide chains that decorate our own cell surface proteins.

Neuraminidase (NA) and hemagglutinin (HA) are major membrane glycoproteins found on the surface of influenza virus. Hemagglutinin binds to the sialic acid-containing receptors on the surface of host cells during initial infection and at the end of an infectious cycle. Neuraminidase, on the other hand, cleaves the HA-sialic acid bondage from the newly formed virions and the host cell receptors during budding. Neuraminidase thus is described as a receptor-destroying enzyme which facilitates virus release and efficient spread of the progeny virus from cell to cell.

Influenza antibody and influenza antibodies are very important research tools for influenza diagnosis, influenza vaccine development, and anti-influenza virus therapy development. Monoclonal or polyclonal antibody can be raised with protein based antigen or peptide based antigen. Antibody raised with protein based antigen could have better specificity and/or binding affinity than antibody raised with peptide based antigen, but cost associated with the recombinant protein antigen is usually higher. Anti influenza virus hemagglutinin (HA) monoclonal antibody or polyclonal antibody can be used for ELISA assay, western blotting detection, Immunohistochemistry (IHC), flow cytometry, neutralization assay, hemagglutinin inhibition assay, and early diagnosis of influenza viral infection.

Sino Biological has developed state-of-the-art monoclonal antibody development technology platforms: mouse monoclonal antibody and rabbit monoclonal antibody. Our rabbit monoclonal antibody platform is one of a kind and offers some unique advantages over mouse monoclonal antibodies, such as high affinity, low cross-reactivity with rabbit polyclonal antibodies.

References
  • Sardet C., et al.,(1989), Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56:271-280.
  • Sardet C., et al., (1990), Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.Science 247:723-726.
  • Tse C.-M., et al.,(1991), Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger.EMBO J. 10:1957-1967.
  • Neuraminidase / NA cDNA ORF Clone, H5N3, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40236-G
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA natural ORF mammalian expression plasmid VG40236-UT
    Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40236-ACGLN
    Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40236-ACG
    Influenza A H5N3 (A/duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40236-ACR
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40236-CF
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40236-NF
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40236-CH
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40236-NH
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40236-CY
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40236-NY
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40236-CM
    Influenza A H5N3 (duck/Hokkaido/167/2007) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40236-NM

    Neuraminidase / NA cDNA ORF Clone, H12N5, Related Products

    Product Name Catalog#(PDF)
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40237-G
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA natural ORF mammalian expression plasmid VG40237-UT
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40237-ACGLN
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40237-ACG
    Influenza A H12N5 (A/green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40237-ACR
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40237-CF
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40237-NF
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40237-CH
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40237-NH
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40237-CY
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40237-NY
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40237-CM
    Influenza A H12N5 (green-winged teal/ALB/199/1991) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40237-NM

    Neuraminidase / NA cDNA ORF Clone, H4N6, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40235-G
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA natural ORF mammalian expression plasmid VG40235-UT
    Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40235-ACG
    Influenza A H4N6 (A/mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40235-ACR
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40235-CF
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40235-NF
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40235-CH
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40235-NH
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40235-CY
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40235-NY
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40235-CM
    Influenza A H4N6 (mallard/Ohio/657/2002) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40235-NM

    Neuraminidase / NA cDNA ORF Clone, H9N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40040-G
    Influenza A H9N2 (A/Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40034-G
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA natural ORF mammalian expression plasmid VG40034-UT
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40040-UT
    Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40040-ACGLN
    Influenza A H9N2 (A/Chicken/Hong Kong/G9/1997) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40034-ACGLN
    Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40040-ACG
    Influenza A H9N2 (A/Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40034-ACG
    Influenza A H9N2 (A/Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40034-ACR
    Influenza A H9N2 (A/Hong Kong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40040-ACR
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40040-CF
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40034-CF
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40034-NF
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40040-NF
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40034-CH
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40040-CH
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40034-NH
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40040-NH
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40040-CY
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40034-CY
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40034-NY
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40040-NY
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40040-CM
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40034-CM
    Influenza A H9N2 (Chicken/Hong Kong/G9/1997) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40034-NM
    Influenza A H9N2 (HongKong/1073/99) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40040-NM

    Neuraminidase / NA cDNA ORF Clone, H10N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA natural ORF mammalian expression plasmid VG40203-G
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA natural ORF mammalian expression plasmid VG40203-UT
    Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Neuraminidase / NA natural ORF mammalian expression plasmid VG40361-UT
    Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40361-ACGLN
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag VG40203-ACGLN
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40203-ACG
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-GFPSpark tag VG40203-ANG
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40203-ACR
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40203-ANR
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40203-CF
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40203-NF
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40203-CH
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40203-NH
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40203-CY
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40203-NY
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40203-CM
    Influenza A H10N8 (A/duck/Guangdong/E1/2012) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40203-NM

    Neuraminidase / NA cDNA ORF Clone, H4N4, Related Products

    Product Name Catalog#(PDF)
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40234-G
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA natural ORF mammalian expression plasmid VG40234-UT
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40234-ACG
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40234-ACGLN
    Influenza A H4N4 (A/mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40234-ACR
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40234-CF
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40234-NF
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40234-CH
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40234-NH
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40234-CY
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40234-NY
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40234-CM
    Influenza A H4N4 (mallard duck/Alberta/299/1977) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40234-NM

    Neuraminidase / NA cDNA ORF Clone, H5N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40389-G
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40389-UT
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40389-ACG
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40389-ACGLN
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA ORF mammalian expression plasmid, N-GFPSpark tag VG40389-ANG
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40389-ACR
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40389-ANR
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40389-CF
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40389-NF
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40389-CH
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40389-NH
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40389-CY
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40389-NY
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40389-CM
    Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014 (Gochang1)) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40389-NM

    Neuraminidase / NA cDNA ORF Clone, H5N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40045-G
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40064-UT
    Influenza A H5N1 (A/Anhui/1/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG11676-G-N
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40045-UT
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40045-ACG
    Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40064-ACGLN
    Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40064-ACG
    Influenza A H5N1 (A/Anhui/1/2005) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11676-ACGLN
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40045-ACGLN
    Influenza A H5N1 (A/Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40064-ACR
    Influenza A H5N1 (A/Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40045-ACR
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40064-CF
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40045-CF
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40045-NF
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40064-NF
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40064-CH
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40045-CH
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40064-NH
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40045-NH
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40064-CY
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40064-NY
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40045-NY
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40064-CM
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40045-CM
    Influenza A H5N1 (Thailand/1(KAN-1)/2004) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40064-NM
    Influenza A H5N1 (Egypt/2321-NAMRU3/2007) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40045-NM

    Neuraminidase / NA cDNA ORF Clone, H3N8, Related Products

    Product Name Catalog#(PDF)
    Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40233-G
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA natural ORF mammalian expression plasmid VG40233-UT
    Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-GFPSpark tag VG40233-ACG
    Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40233-ACGLN
    Influenza A H3N8 (A/canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40233-ACR
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-Flag tag VG40233-CF
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, N-Flag tag VG40233-NF
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-His tag VG40233-CH
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, N-His tag VG40233-NH
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-HA tag VG40233-CY
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, N-HA tag VG40233-NY
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, C-Myc tag VG40233-CM
    Influenza A H3N8 (canine/New York/145353/2008) Neuraminidase / NA ORF mammalian expression plasmid, N-Myc tag VG40233-NM

    Neuraminidase / NA cDNA ORF Clone, H3N2, Related Products

    Product Name Catalog#(PDF)
    Influenza A H3N2 (A/Babol/36/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40017-C
    Influenza A H3N2 (A/Aichi/2/1968) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40199-G-N
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40017-UT
    Influenza A H3N2 (A/Memphis/1/68) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40201-G-N
    Influenza A H3N2 (A/Babol/36/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-tagged VG40017-ACG
    Influenza A H3N2 (A/Memphis/1/68) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40201-ACGLN
    Influenza A H3N2 (A/Aichi/2/1968) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40199-ACGLN
    Influenza A H3N2 (A/Babol/36/2005) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40017-ACGLN
    Influenza A H3N2 (A/Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40017-ACR
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG40017-CF
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40017-NF
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40017-CH
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40017-NH
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40017-CY
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40017-NY
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40017-CM
    Influenza A H3N2 (Babol/36/2005) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), N-Myc-tagged VG40017-NM

    Neuraminidase / NA cDNA ORF Clone, H1N1, Related Products

    Product Name Catalog#(PDF)
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG11058-UT
    Influenza A H1N1 (A/USSR/90/1977) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40197-UT
    Influenza A H1N1 (A/Puerto Rico/8/1934) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40196-UT
    Influenza A H1N1 (A/Puerto Rico/8/1934) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40196-ACGLN
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tag VG11058-ACG
    Influenza A H1N1 (A/USSR/90/1977) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40197-ACGLN
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11058-ACR
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized), C-Flag tag VG11058-CF
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG11058-NF
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG11058-NH
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG11058-NY
    Influenza A H1N1 (A/California/04/2009) Neuraminidase / NA (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG11058-NM

    Neuraminidase / NA cDNA ORF Clone, H7N9, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase ORF mammalian expression plasmid (Codon Optimized) VG40108-UT
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase ORF mammalian expression plasmid (Codon Optimized) VG40109-UT
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40108-ACGLN
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tag VG40109-ACG
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40108-ACG
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40109-ACGLN
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark tag VG40108-ACR
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40109-ACR
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40108-CF
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40109-CF
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40109-NF
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40108-NF
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40109-CH
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40108-CH
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40108-CY
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40109-CY
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40108-NY
    Influenza A H7N9 (A/Shanghai/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40109-CM
    Influenza A H7N9 (A/Anhui/1/2013) Neuraminidase (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40108-NM

    Neuraminidase / NA cDNA ORF Clone, H7N7, Related Products

    Product Name Catalog#(PDF)
    Influenza A H7N7 (A/Netherlands/219/2003) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40202-UT

    Neuraminidase / NA cDNA ORF Clone, Influenza B, Related Products

    Product Name Catalog#(PDF)
    Influenza B (B/PHUKET/3073/2013) Neuraminidase / NA ORF mammalian expression plasmid (Codon Optimized) VG40502-UT
    Influenza B (B/PHUKET/3073/2013) Neuraminidase / NA Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40502-ACGLN
    info info
    添加购物车成功! 添加购物车失败!