WTAP cDNA ORF Clone, Human, untagged

Cat: HG12018-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All WTAP Reagents
CRO Services
Product recommended

All WTAP Reagents
WTAP cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human Wilms tumor 1 associated protein.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6.1kb + 1.19kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
WTAP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

WTAP cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
WTAP cDNA ORF Clone, Human, untagged Alternative Names
Mum2 cDNA ORF Clone, Human
WTAP Background Information

Wilms' tumor 1-associating protein (WTAP) was previously identified as a protein associated with Wilms' tumor-1 (WT-1) protein that is essential for the development of the genitourinary system. WT1 was originally identified as a tumor suppressor for Wilms' tumor, but it is also overexpressed in a variety of cancer cells. The WTAP-WT1 axis in vascular cells suggest that WTAP is a vital and multifaceted regulator of vascular remodeling. WTAP has been suggested to function in alternative splicing, stabilization of mRNA, and cell growth. Knocking down endogenous WTAP increased Smooth muscle cells (SMCs) proliferation, because of increased DNA synthesis and G(1)/S phase transition, together with reduced apoptosis. These effects could be the result of WTAP suppressing the transcriptional activity of WT1 in SMCs. WTAP may thus also play a role in messenger RNA processing in mammalian cells, either dependent on or independent of its interaction with WT1.

Full Name
Wilms tumor 1 associated protein
References
  • Fukusumi Y, et al. (2008) Wtap is required for differentiation of endoderm and mesoderm in the mouse embryo. Dev Dyn. 237(3): 618-29.
  • Small TW, et al. (2007) Vascular biology and the sex of flies: regulation of vascular smooth muscle cell proliferation by wilms' tumor 1-associating protein. Trends Cardiovasc Med. 17(7): 230-4.
  • Small TW, et al. (2006) Wilms' tumor 1-associating protein regulates the proliferation of vascular smooth muscle cells. Circ Res. 99(12): 1338-46.
  • Rong Y, et al. (2006) Wilms' tumor 1 and signal transducers and activators of transcription 3 synergistically promote cell proliferation: a possible mechanism in sporadic Wilms' tumor. Cancer Res. 66(16): 8049-57.
  • WTAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    WTAP cDNA ORF Clone in Cloning Vector, Mouse MG52198-G
    WTAP cDNA ORF Clone, Mouse, untagged MG52198-UT
    WTAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52198-ACGLN
    WTAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52198-ACG
    WTAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52198-ANG
    WTAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52198-ACR
    WTAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52198-ANR
    WTAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52198-CF
    WTAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52198-NF
    WTAP cDNA ORF Clone, Mouse, C-His tag MG52198-CH
    WTAP cDNA ORF Clone, Mouse, N-His tag MG52198-NH
    WTAP cDNA ORF Clone, Mouse, C-HA tag MG52198-CY
    WTAP cDNA ORF Clone, Mouse, N-HA tag MG52198-NY
    WTAP cDNA ORF Clone, Mouse, C-Myc tag MG52198-CM
    WTAP cDNA ORF Clone, Mouse, N-Myc tag MG52198-NM
    WTAP qPCR Primer Pairs, Mouse MP202071

    WTAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    WTAP cDNA ORF Clone in Cloning Vector, Human HG12018-G
    WTAP cDNA ORF Clone, Human, C-GFPSpark® tag HG12018-ACG
    WTAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12018-ACGLN
    WTAP cDNA ORF Clone, Human, N-GFPSpark® tag HG12018-ANG
    WTAP cDNA ORF Clone, Human, C-OFPSpark® tag HG12018-ACR
    WTAP cDNA ORF Clone, Human, N-OFPSpark® tag HG12018-ANR
    WTAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12018-G-F
    WTAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12018-CF
    WTAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12018-NF
    WTAP cDNA ORF Clone, Human, C-His tag HG12018-CH
    WTAP cDNA ORF Clone, Human, N-His tag HG12018-NH
    WTAP cDNA ORF Clone, Human, C-HA tag HG12018-CY
    WTAP cDNA ORF Clone, Human, N-HA tag HG12018-NY
    WTAP cDNA ORF Clone, Human, C-Myc tag HG12018-CM
    WTAP cDNA ORF Clone, Human, N-Myc tag HG12018-NM
    WTAP qPCR Primer Pairs, Human HP101554
    info info
    添加购物车成功! 添加购物车失败!