FLT4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10806-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All FLT4 Reagents
CRO Services
Product recommended

All FLT4 Reagents
FLT4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3897 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fms-related tyrosine kinase 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Restriction Sites
HindIII + XbaI (6kb + 3.92kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
FLT4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FLT4 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human HER2/ERBB2 Gene Plasmid Map 5632
FLT4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
FLT-4 cDNA ORF Clone, Human;FLT-41 cDNA ORF Clone, Human;FLT41 cDNA ORF Clone, Human;LMPH1A cDNA ORF Clone, Human;PCL cDNA ORF Clone, Human;VEGF Receptor 3 cDNA ORF Clone, Human;VEGFR-3 cDNA ORF Clone, Human;VEGFR3 cDNA ORF Clone, Human
FLT4 Background Information

Vascular endothelial growth factor receptor 3 (VEGFR3), also known as FLT-4, together with the other two members VEGFR1 (FLT-1) and VEGFR2 (KDR/Flk-1) are receptors for vascular endothelial growth factors (VEGF) and belong to the class III subfamily of receptor tyrosine kinases (RTKs). The VEGFR3 protein is expressed mainly on lymphatic vessels but it is also up-regulated in tumor angiogenesis. Mutations in VEGFR3 have been identified in patients with primary lymphoedema. The VEGF-C/VEGF-D/VEGFR3 signaling pathway may provide a target for antilymphangiogenic therapy in prostate cancer, breast cancer, gastric cancer, lung cancer, non-small cell lung cancer (NSCLC), and so on.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
fms related tyrosine kinase 4
References
  • Shushanov S, et al. (2000)VEGFc and VEGFR3 expression in human thyroid pathologies. Int J Cancer.86(1): 47-52.
  • Iljin K, et al. (2001) VEGFR3 gene structure, regulatory region, and sequence polymorphisms. FASEB J. 15(6): 1028-36.
  • Liu XE, et al. (2004) Expression and significance of VEGF-C and FLT-4 in gastric cancer. World J Gastroenterol. 10(3): 352-5.
  • Stearns ME, et al. (2004) Expression of a flt-4 (VEGFR3) splicing variant in primary human prostate tumors. VEGF D and flt-4t(Delta773-1081) overexpression is diagnostic for sentinel lymph node metastasis. Lab Invest. 84(6): 785-95.
  • FLT4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    FLT4 cDNA ORF Clone in Cloning Vector, Mouse MG50584-M
    FLT4 cDNA ORF Clone, Mouse, untagged MG50584-UT
    FLT4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50584-ACGLN
    FLT4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50584-ACG
    FLT4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50584-ACR
    FLT4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50584-CF
    FLT4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50584-NF
    FLT4 cDNA ORF Clone, Mouse, C-His tag MG50584-CH
    FLT4 cDNA ORF Clone, Mouse, N-His tag MG50584-NH
    FLT4 cDNA ORF Clone, Mouse, C-HA tag MG50584-CY
    FLT4 cDNA ORF Clone, Mouse, N-HA tag MG50584-NY
    FLT4 cDNA ORF Clone, Mouse, C-Myc tag MG50584-CM
    FLT4 cDNA ORF Clone, Mouse, N-Myc tag MG50584-NM
    FLT4 qPCR Primer Pairs, Mouse MP200662

    FLT4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    FLT4 cDNA ORF Clone in Cloning Vector, Human HG10806-M
    FLT4 cDNA ORF Clone, Human, untagged HG10806-UT
    FLT4 cDNA ORF Clone, Human, untagged HG29697-UT
    FLT4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10806-ACGLN
    FLT4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29697-ACGLN
    FLT4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10806-ACG
    FLT4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10806-ACR
    FLT4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29697-CF
    FLT4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10806-CF
    FLT4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10806-NF
    FLT4 cDNA ORF Clone, Human, C-His tag HG10806-CH
    FLT4 cDNA ORF Clone, Human, N-His tag HG10806-NH
    FLT4 cDNA ORF Clone, Human, C-HA tag HG10806-CY
    FLT4 cDNA ORF Clone, Human, N-HA tag HG10806-NY
    FLT4 cDNA ORF Clone, Human, C-Myc tag HG10806-CM
    FLT4 qPCR Primer Pairs, Human HP100911
    info info
    添加购物车成功! 添加购物车失败!