UGT2A3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13741-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UGT2A3 Reagents
CRO Services
Product recommended

All UGT2A3 Reagents
UGT2A3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1584 bp
Description
Full length Clone DNA of Human UDP glucuronosyltransferase 2 family, polypeptide A3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UGT2A3 Background Information
Full Name
UDP glucuronosyltransferase 2 family, polypeptide A3

UGT2A3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UGT2A3 cDNA ORF Clone in Cloning Vector, Mouse MG55999-U
UGT2A3 cDNA ORF Clone, Mouse, untagged MG55999-UT
UGT2A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55999-ACGLN
UGT2A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG55999-ACG
UGT2A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG55999-ACR
UGT2A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG55999-CF
UGT2A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG55999-NF
UGT2A3 cDNA ORF Clone, Mouse, C-His tag MG55999-CH
UGT2A3 cDNA ORF Clone, Mouse, N-His tag MG55999-NH
UGT2A3 cDNA ORF Clone, Mouse, C-HA tag MG55999-CY
UGT2A3 cDNA ORF Clone, Mouse, N-HA tag MG55999-NY
UGT2A3 cDNA ORF Clone, Mouse, C-Myc tag MG55999-CM
UGT2A3 cDNA ORF Clone, Mouse, N-Myc tag MG55999-NM

UGT2A3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UGT2A3 cDNA ORF Clone in Cloning Vector, Human HG13741-G
UGT2A3 cDNA ORF Clone, Human, untagged HG13741-UT
UGT2A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13741-ACGLN
UGT2A3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13741-ACG
UGT2A3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13741-ACR
UGT2A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13741-CF
UGT2A3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13741-NF
UGT2A3 cDNA ORF Clone, Human, C-His tag HG13741-CH
UGT2A3 cDNA ORF Clone, Human, N-His tag HG13741-NH
UGT2A3 cDNA ORF Clone, Human, C-HA tag HG13741-CY
UGT2A3 cDNA ORF Clone, Human, N-HA tag HG13741-NY
UGT2A3 cDNA ORF Clone, Human, C-Myc tag HG13741-CM
UGT2A3 qPCR Primer Pairs, Human HP102418
info info
添加购物车成功! 添加购物车失败!