U2AF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16331-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All U2AF1 Reagents
CRO Services
Product recommended

All U2AF1 Reagents
U2AF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human U2 small nuclear RNA auxiliary factor 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

U2AF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
FP793 cDNA ORF Clone, Human;RN cDNA ORF Clone, Human;RNU2AF1 cDNA ORF Clone, Human;U2AF35 cDNA ORF Clone, Human;U2AFBP cDNA ORF Clone, Human
U2AF1 Background Information
Full Name
U2 small nuclear RNA auxiliary factor 1

U2AF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
U2AF1 cDNA ORF Clone in Cloning Vector, Rat RG8A4531-U
U2AF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4531-ACGLN

U2AF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
U2AF1 cDNA ORF Clone in Cloning Vector, Mouse MG5A2108-U
U2AF1 cDNA ORF Clone, Mouse, untagged MG5A2108-UT
U2AF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2108-ACGLN
U2AF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2108-ACG
U2AF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2108-ANG
U2AF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2108-ACR
U2AF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2108-ANR
U2AF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2108-CF
U2AF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2108-NF
U2AF1 cDNA ORF Clone, Mouse, C-His tag MG5A2108-CH
U2AF1 cDNA ORF Clone, Mouse, N-His tag MG5A2108-NH
U2AF1 cDNA ORF Clone, Mouse, C-HA tag MG5A2108-CY
U2AF1 cDNA ORF Clone, Mouse, N-HA tag MG5A2108-NY
U2AF1 cDNA ORF Clone, Mouse, C-Myc tag MG5A2108-CM
U2AF1 cDNA ORF Clone, Mouse, N-Myc tag MG5A2108-NM

U2AF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
U2AF1 cDNA ORF Clone in Cloning Vector, Human HG16331-G
U2AF1 cDNA ORF Clone, Human, untagged HG16331-UT
U2AF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16331-ACGLN
U2AF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16331-ACG
U2AF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16331-ANG
U2AF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16331-ACR
U2AF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16331-ANR
U2AF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16331-CF
U2AF1 cDNA ORF Clone, Human, C-His tag HG16331-CH
U2AF1 cDNA ORF Clone, Human, N-His tag HG16331-NH
U2AF1 cDNA ORF Clone, Human, C-HA tag HG16331-CY
U2AF1 cDNA ORF Clone, Human, N-HA tag HG16331-NY
U2AF1 cDNA ORF Clone, Human, C-Myc tag HG16331-CM
U2AF1 cDNA ORF Clone, Human, N-Myc tag HG16331-NM
U2AF1 qPCR Primer Pairs, Human HP105084
info info
添加购物车成功! 添加购物车失败!