TPI1 cDNA ORF Clone, Human, untagged

Cat: HG16150-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TPI1 Reagents
CRO Services
Product recommended

All TPI1 Reagents
TPI1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Human triosephosphate isomerase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPI1 cDNA ORF Clone, Human, untagged Alternative Names
HEL-S-49 cDNA ORF Clone, Human;TIM cDNA ORF Clone, Human;TPI cDNA ORF Clone, Human;TPID cDNA ORF Clone, Human
TPI1 Background Information
Full Name
triosephosphate isomerase 1

TPI1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
TPI1 cDNA ORF Clone in Cloning Vector, Canine DG70214-U
TPI1 cDNA ORF Clone, Canine, untagged DG70214-UT
TPI1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70214-ACG
TPI1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70214-ACGLN
TPI1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70214-ANG
TPI1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70214-ACR
TPI1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70214-ANR
TPI1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70214-CF
TPI1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70214-NF
TPI1 cDNA ORF Clone, Canine, C-His tag DG70214-CH
TPI1 cDNA ORF Clone, Canine, N-His tag DG70214-NH
TPI1 cDNA ORF Clone, Canine, C-HA tag DG70214-CY
TPI1 cDNA ORF Clone, Canine, N-HA tag DG70214-NY
TPI1 cDNA ORF Clone, Canine, C-Myc tag DG70214-CM
TPI1 cDNA ORF Clone, Canine, N-Myc tag DG70214-NM

TPI1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TPI1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90811-G
TPI1 cDNA ORF Clone, Cynomolgus, untagged CG90811-UT
TPI1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90811-ACG
TPI1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90811-ACGLN
TPI1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90811-ANG
TPI1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90811-ACR
TPI1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90811-ANR
TPI1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90811-CF
TPI1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90811-NF
TPI1 cDNA ORF Clone, Cynomolgus, C-His tag CG90811-CH
TPI1 cDNA ORF Clone, Cynomolgus, N-His tag CG90811-NH
TPI1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90811-CY
TPI1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90811-NY
TPI1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90811-CM
TPI1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90811-NM

TPI1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TPI1 cDNA ORF Clone in Cloning Vector, Rat RG80913-U
TPI1 cDNA ORF Clone, Rat, untagged RG80913-UT
TPI1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80913-ACGLN
TPI1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80913-ACG
TPI1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80913-ANG
TPI1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80913-ACR
TPI1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80913-ANR
TPI1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80913-CF
TPI1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80913-NF
TPI1 cDNA ORF Clone, Rat, C-His tag RG80913-CH
TPI1 cDNA ORF Clone, Rat, N-His tag RG80913-NH
TPI1 cDNA ORF Clone, Rat, C-HA tag RG80913-CY
TPI1 cDNA ORF Clone, Rat, N-HA tag RG80913-NY
TPI1 cDNA ORF Clone, Rat, C-Myc tag RG80913-CM
TPI1 cDNA ORF Clone, Rat, N-Myc tag RG80913-NM
TPI1 qPCR Primer Pairs, Rat RP300877

TPI1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TPI1 cDNA ORF Clone in Cloning Vector, Human HG16150-G
TPI1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16150-ACGLN
TPI1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16150-ACG
TPI1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16150-ANG
TPI1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16150-ACR
TPI1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16150-ANR
TPI1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16150-CF
TPI1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16150-NF
TPI1 cDNA ORF Clone, Human, C-His tag HG16150-CH
TPI1 cDNA ORF Clone, Human, N-His tag HG16150-NH
TPI1 cDNA ORF Clone, Human, C-HA tag HG16150-CY
TPI1 cDNA ORF Clone, Human, N-HA tag HG16150-NY
TPI1 cDNA ORF Clone, Human, C-Myc tag HG16150-CM
TPI1 cDNA ORF Clone, Human, N-Myc tag HG16150-NM
TPI1 qPCR Primer Pairs, Human HP104919
info info
添加购物车成功! 添加购物车失败!