TOR3A cDNA ORF Clone, Human, untagged

Cat: HG13289-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TOR3A Reagents
CRO Services
Product recommended

All TOR3A Reagents
TOR3A cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1194 bp
Description
Full length Clone DNA of Human torsin family 3, member A.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TOR3A cDNA ORF Clone, Human, untagged Alternative Names
ADIR cDNA ORF Clone, Human;ADIR2 cDNA ORF Clone, Human
TOR3A Background Information
Full Name
torsin family 3, member A

TOR3A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TOR3A cDNA ORF Clone in Cloning Vector, Mouse MG53888-U
TOR3A cDNA ORF Clone, Mouse, untagged MG53888-UT
TOR3A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53888-ACGLN
TOR3A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53888-ACG
TOR3A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53888-ANG
TOR3A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53888-ACR
TOR3A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53888-ANR
TOR3A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53888-CF
TOR3A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53888-NF
TOR3A cDNA ORF Clone, Mouse, C-His tag MG53888-CH
TOR3A cDNA ORF Clone, Mouse, N-His tag MG53888-NH
TOR3A cDNA ORF Clone, Mouse, C-HA tag MG53888-CY
TOR3A cDNA ORF Clone, Mouse, N-HA tag MG53888-NY
TOR3A cDNA ORF Clone, Mouse, C-Myc tag MG53888-CM
TOR3A cDNA ORF Clone, Mouse, N-Myc tag MG53888-NM

TOR3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TOR3A cDNA ORF Clone in Cloning Vector, Human HG13289-G
TOR3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13289-ACGLN
TOR3A cDNA ORF Clone, Human, C-GFPSpark® tag HG13289-ACG
TOR3A cDNA ORF Clone, Human, N-GFPSpark® tag HG13289-ANG
TOR3A cDNA ORF Clone, Human, C-OFPSpark® tag HG13289-ACR
TOR3A cDNA ORF Clone, Human, N-OFPSpark® tag HG13289-ANR
TOR3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13289-CF
TOR3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13289-NF
TOR3A cDNA ORF Clone, Human, C-His tag HG13289-CH
TOR3A cDNA ORF Clone, Human, N-His tag HG13289-NH
TOR3A cDNA ORF Clone, Human, C-HA tag HG13289-CY
TOR3A cDNA ORF Clone, Human, N-HA tag HG13289-NY
TOR3A cDNA ORF Clone, Human, C-Myc tag HG13289-CM
TOR3A cDNA ORF Clone, Human, N-Myc tag HG13289-NM
TOR3A qPCR Primer Pairs, Human HP101997
info info
添加购物车成功! 添加购物车失败!