TMED4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13729-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TMED4 Reagents

CRO Services

Product recommended


All TMED4 Reagents

TMED4 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
684 bp
Description
Full length Clone DNA of Human transmembrane emp24 protein transport domain conta with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMED4 cDNA ORF Clone, Human, N-Myc tag Alternative Names

ERS25 cDNA ORF Clone, Human;GMP25iso cDNA ORF Clone, Human;HNLF cDNA ORF Clone, Human;p24alpha3 cDNA ORF Clone, Human

TMED4 Background Information

TMED4, also known as ERS25, belongs to the EMP24/GP25L family. TMED4 may play a role in the regulation of heat-shock response and apoptosis. It is involved in vesicular protein trafficking, mainly in the early secretory pathway. TMED4 may also play a role in the biosynthesis of secreted cargo including processing. It functions in the regulation of heat-shock response and apoptosis. TMED4 also is involved in endoplasmic reticulum stress response.

Full Name
transmembrane emp24 protein transport domain containing 4
References
  • Hartley JL. et al., 2001, Genome Res. 10 (11): 1788-95.
  • Matoba R. et al., 1994, Gene. 146 (2): 199-207.
  • Matsuda A. et al., 2003, Oncogene. 22 (21): 3307-18.
  • TMED4 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TMED4 cDNA ORF Clone in Cloning Vector, Rat RG81363-G

    TMED4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TMED4 cDNA ORF Clone in Cloning Vector, Mouse MG52950-G
    TMED4 cDNA ORF Clone, Mouse, untagged MG52950-UT
    TMED4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52950-ACGLN
    TMED4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52950-ACG
    TMED4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52950-ANG
    TMED4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52950-ACR
    TMED4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52950-ANR
    TMED4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52950-CF
    TMED4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52950-NF
    TMED4 cDNA ORF Clone, Mouse, C-His tag MG52950-CH
    TMED4 cDNA ORF Clone, Mouse, N-His tag MG52950-NH
    TMED4 cDNA ORF Clone, Mouse, C-HA tag MG52950-CY
    TMED4 cDNA ORF Clone, Mouse, N-HA tag MG52950-NY
    TMED4 cDNA ORF Clone, Mouse, C-Myc tag MG52950-CM
    TMED4 cDNA ORF Clone, Mouse, N-Myc tag MG52950-NM

    TMED4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TMED4 cDNA ORF Clone in Cloning Vector, Human HG13729-G
    TMED4 cDNA ORF Clone, Human, untagged HG13729-UT
    TMED4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13729-ACGLN
    TMED4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13729-ACG
    TMED4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13729-ACR
    TMED4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13729-CF
    TMED4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13729-NF
    TMED4 cDNA ORF Clone, Human, C-His tag HG13729-CH
    TMED4 cDNA ORF Clone, Human, N-His tag HG13729-NH
    TMED4 cDNA ORF Clone, Human, C-HA tag HG13729-CY
    TMED4 cDNA ORF Clone, Human, N-HA tag HG13729-NY
    TMED4 cDNA ORF Clone, Human, C-Myc tag HG13729-CM
    TMED4 qPCR Primer Pairs, Human HP102406
    info info
    添加购物车成功! 添加购物车失败!