TFPI cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10564-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TFPI Reagents
CRO Services
Product recommended

All TFPI Reagents
TFPI cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
918 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.92kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
TFPI cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TFPI cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
Human TFPI  Gene Expression validated Image 16651
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
TFPI cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
EPI cDNA ORF Clone, Human;LACI cDNA ORF Clone, Human;TFI cDNA ORF Clone, Human;TFPI1 cDNA ORF Clone, Human
TFPI Background Information

Tissue factor pathway inhibitor (TFPI) is the natural inhibitor of TF coagulant and signaling activities. It is a Kunitz-type serine proteinase inhibitor that down-regulates tissue factor-initiated blood coagulation. With its Kunitz domains, TFPI exhibits significant homology with human inter-alpha-trypson inhibitor and bovin basic pancreatic trypsin inhibitor. TFPI is the natural inhibitor of TF coagulant and signaling activities. The importance of TFPI in the regulation of blood coagulation is emphasized by how its activity is modulated in human disease. In a factor (F) Xa-dependent feedback system, TFPI binds directly and inhibits the TF-FVII/FVIIa complex. Normally, TFPI exists in plasma both as a full-length molecule and as variably carboxy-terminal truncated forms. TFPI also circulates in complex with plasma lipoproteins. The levels and the dual inhibitor effect of TFPI on FXa and TF-FVII/FVIIa complex offers insight into the mechanisms of various pathological conditions triggered by TF. TFPI may play an important role in modulating TF-induced thrombogenesis and it may also provide a unique therapeutic approach for prophylaxis and/or treatment of various diseases. In addition, Studies have shown that TFPI exhibits antiangiogenic and antimetastatic effects in vitro and in vivo. In animal models of experimental metastasis, both circulating and tumor cell-associated TFPI are shown to significantly reduce tumor cell-induced coagulation activation and lung metastasis.

Full Name
tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)
References
  • Lwaleed BA, et al. (2006) Tissue factor pathway inhibitor: structure, biology and involvement in disease. J Pathol. 208(3): 327-39.
  • Amirkhosravi A, et al. (2007) The role of tissue factor pathway inhibitor in tumor growth and metastasis. Semin Thromb Hemost. 33(7): 643-52.
  • Maroney SA, et al. (2008) Expression of tissue factor pathway inhibitor by endothelial cells and platelets. Transfus Apher Sci. 38(1): 9-14.
  • TFPI cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TFPI cDNA ORF Clone, Rat, untagged RG83097-UT
    TFPI Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83097-ACGLN
    TFPI cDNA ORF Clone, Rat, C-GFPSpark® tag RG83097-ACG
    TFPI cDNA ORF Clone, Rat, C-OFPSpark® tag RG83097-ACR
    TFPI cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83097-CF
    TFPI cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83097-NF
    TFPI cDNA ORF Clone, Rat, C-His tag RG83097-CH
    TFPI cDNA ORF Clone, Rat, N-His tag RG83097-NH
    TFPI cDNA ORF Clone, Rat, C-HA tag RG83097-CY
    TFPI cDNA ORF Clone, Rat, N-HA tag RG83097-NY
    TFPI cDNA ORF Clone, Rat, C-Myc tag RG83097-CM
    TFPI cDNA ORF Clone, Rat, N-Myc tag RG83097-NM

    TFPI cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TFPI cDNA ORF Clone in Cloning Vector, Mouse MG50131-M
    TFPI cDNA ORF Clone, Mouse, untagged MG50131-UT
    TFPI Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50131-ACGLN
    TFPI cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50131-ACG
    TFPI cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50131-ACR
    TFPI cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50131-CF
    TFPI cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50131-NF
    TFPI cDNA ORF Clone, Mouse, C-His tag MG50131-CH
    TFPI cDNA ORF Clone, Mouse, N-His tag MG50131-NH
    TFPI cDNA ORF Clone, Mouse, C-HA tag MG50131-CY
    TFPI cDNA ORF Clone, Mouse, N-HA tag MG50131-NY
    TFPI cDNA ORF Clone, Mouse, C-Myc tag MG50131-CM
    TFPI cDNA ORF Clone, Mouse, N-Myc tag MG50131-NM
    TFPI qPCR Primer Pairs, Mouse MP200161

    TFPI cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TFPI cDNA ORF Clone in Cloning Vector, Human HG10564-M
    TFPI cDNA ORF Clone, Human, untagged HG10564-UT
    TFPI Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10564-ACGLN
    TFPI cDNA ORF Clone, Human, C-GFPSpark® tag HG10564-ACG
    TFPI cDNA ORF Clone, Human, C-OFPSpark® tag HG10564-ACR
    TFPI cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10564-CF
    TFPI cDNA ORF Clone, Human, C-His tag HG10564-CH
    TFPI cDNA ORF Clone, Human, N-His tag HG10564-NH
    TFPI cDNA ORF Clone, Human, C-HA tag HG10564-CY
    TFPI cDNA ORF Clone, Human, N-HA tag HG10564-NY
    TFPI cDNA ORF Clone, Human, C-Myc tag HG10564-CM
    TFPI cDNA ORF Clone, Human, N-Myc tag HG10564-NM
    TFPI qPCR Primer Pairs, Human HP100855
    info info
    添加购物车成功! 添加购物车失败!