CKAP1 cDNA ORF Clone, Human, untagged

Cat: HG14260-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CKAP1 Reagents
CRO Services
Product recommended

All CKAP1 Reagents
CKAP1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Human tubulin folding cofactor B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKAP1 cDNA ORF Clone, Human, untagged Alternative Names
CG22 cDNA ORF Clone, Human;CKAP1 cDNA ORF Clone, Human;CKAPI cDNA ORF Clone, Human
CKAP1 Background Information

Tubulin-folding cofactor B, also known as TBCB, belongs to the TBCB family. It contains 1 CAP-Gly domain and can be detected in most tissues. TBCB binds to alpha-tubulin folding intermediates after their interaction with cytosolic chaperonin in the pathway. The cytoskeleton is composed of 3 structural elements: actin filaments, microtubules, and intermediate filaments. TBCB is involved in regulation of tubulin heterodimer dissociation. It may function as a negative regulator of axonal growth.

Full Name
tubulin folding cofactor B
References
  • Feingold EA, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Tian G, et al. (1997) Tubulin subunits exist in an activated conformational state generated and maintained by protein cofactors. J Cell Biol. 138(4):821-32.
  • Wolz W, et al. (1997) A complex satellite DNA polymorphism flanking the human ryanodine receptor gene (RYR1). Cytogenet Cell Genet. 72(2-3):215-6.
  • CKAP1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CKAP1 cDNA ORF Clone in Cloning Vector, Rat RG81649-G
    CKAP1 cDNA ORF Clone, Rat, untagged RG81649-UT
    CKAP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81649-ACG
    CKAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81649-ACGLN
    CKAP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81649-ANG
    CKAP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81649-ACR
    CKAP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81649-ANR
    CKAP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81649-CF
    CKAP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81649-NF
    CKAP1 cDNA ORF Clone, Rat, C-His tag RG81649-CH
    CKAP1 cDNA ORF Clone, Rat, N-His tag RG81649-NH
    CKAP1 cDNA ORF Clone, Rat, C-HA tag RG81649-CY
    CKAP1 cDNA ORF Clone, Rat, N-HA tag RG81649-NY
    CKAP1 cDNA ORF Clone, Rat, C-Myc tag RG81649-CM
    CKAP1 cDNA ORF Clone, Rat, N-Myc tag RG81649-NM

    CKAP1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CKAP1 cDNA ORF Clone in Cloning Vector, Mouse MG53403-U
    CKAP1 cDNA ORF Clone, Mouse, untagged MG53403-UT
    CKAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53403-ACG
    CKAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53403-ACGLN
    CKAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53403-ANG
    CKAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53403-ACR
    CKAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53403-ANR
    CKAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53403-CF
    CKAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53403-NF
    CKAP1 cDNA ORF Clone, Mouse, C-His tag MG53403-CH
    CKAP1 cDNA ORF Clone, Mouse, N-His tag MG53403-NH
    CKAP1 cDNA ORF Clone, Mouse, C-HA tag MG53403-CY
    CKAP1 cDNA ORF Clone, Mouse, N-HA tag MG53403-NY
    CKAP1 cDNA ORF Clone, Mouse, C-Myc tag MG53403-CM
    CKAP1 cDNA ORF Clone, Mouse, N-Myc tag MG53403-NM

    CKAP1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CKAP1 cDNA ORF Clone in Cloning Vector, Human HG14260-G
    CKAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14260-ACGLN
    CKAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14260-ACG
    CKAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14260-ANG
    CKAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14260-ACR
    CKAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14260-ANR
    CKAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14260-CF
    CKAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14260-NF
    CKAP1 cDNA ORF Clone, Human, C-His tag HG14260-CH
    CKAP1 cDNA ORF Clone, Human, N-His tag HG14260-NH
    CKAP1 cDNA ORF Clone, Human, C-HA tag HG14260-CY
    CKAP1 cDNA ORF Clone, Human, N-HA tag HG14260-NY
    CKAP1 cDNA ORF Clone, Human, C-Myc tag HG14260-CM
    CKAP1 cDNA ORF Clone, Human, N-Myc tag HG14260-NM
    CKAP1 qPCR Primer Pairs, Human HP102910
    info info
    添加购物车成功! 添加购物车失败!