SUMO2 cDNA ORF Clone, Human, N-HA tag

Cat: HG13443-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SUMO2 Reagents
CRO Services
Product recommended

All SUMO2 Reagents
SUMO2 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
330 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Restriction Sites
KpnI + XbaI(6kb+0.33kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SUMO2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SUMO2 cDNA ORF Clone, Human, N-HA tag Validated Images
Cynomolgus LOC101926731 Gene Plasmid Map 5628
SUMO2 cDNA ORF Clone, Human, N-HA tag Alternative Names
HSMT3 cDNA ORF Clone, Human;Smt3A cDNA ORF Clone, Human;SMT3B cDNA ORF Clone, Human;SMT3H2 cDNA ORF Clone, Human;SUMO3 cDNA ORF Clone, Human
SUMO2 Background Information
Full Name
small ubiquitin-like modifier 2

SUMO2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SUMO2 cDNA ORF Clone in Cloning Vector, Rhesus CG90585-G
SUMO2 cDNA ORF Clone, Rhesus, untagged CG90585-UT
SUMO2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90585-ACGLN
SUMO2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90585-ACG
SUMO2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90585-ANG
SUMO2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90585-ACR
SUMO2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90585-ANR
SUMO2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90585-CF
SUMO2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90585-NF
SUMO2 cDNA ORF Clone, Rhesus, C-His tag CG90585-CH
SUMO2 cDNA ORF Clone, Rhesus, N-His tag CG90585-NH
SUMO2 cDNA ORF Clone, Rhesus, C-HA tag CG90585-CY
SUMO2 cDNA ORF Clone, Rhesus, N-HA tag CG90585-NY
SUMO2 cDNA ORF Clone, Rhesus, C-Myc tag CG90585-CM
SUMO2 cDNA ORF Clone, Rhesus, N-Myc tag CG90585-NM

SUMO2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SUMO2 cDNA ORF Clone in Cloning Vector, Rat RG80741-U
SUMO2 cDNA ORF Clone, Rat, untagged RG80741-UT
SUMO2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80741-ACGLN
SUMO2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80741-ACG
SUMO2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80741-ANG
SUMO2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80741-ACR
SUMO2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80741-ANR
SUMO2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80741-CF
SUMO2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80741-NF
SUMO2 cDNA ORF Clone, Rat, C-His tag RG80741-CH
SUMO2 cDNA ORF Clone, Rat, N-His tag RG80741-NH
SUMO2 cDNA ORF Clone, Rat, C-HA tag RG80741-CY
SUMO2 cDNA ORF Clone, Rat, N-HA tag RG80741-NY
SUMO2 cDNA ORF Clone, Rat, C-Myc tag RG80741-CM
SUMO2 cDNA ORF Clone, Rat, N-Myc tag RG80741-NM
SUMO2 qPCR Primer Pairs, Rat RP300705

SUMO2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SUMO2 cDNA ORF Clone in Cloning Vector, Mouse MG51704-G
SUMO2 cDNA ORF Clone, Mouse, untagged MG51704-UT
SUMO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51704-ACGLN
SUMO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51704-ACG
SUMO2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51704-ANG
SUMO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51704-ACR
SUMO2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51704-ANR
SUMO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51704-CF
SUMO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51704-NF
SUMO2 cDNA ORF Clone, Mouse, C-His tag MG51704-CH
SUMO2 cDNA ORF Clone, Mouse, N-His tag MG51704-NH
SUMO2 cDNA ORF Clone, Mouse, C-HA tag MG51704-CY
SUMO2 cDNA ORF Clone, Mouse, N-HA tag MG51704-NY
SUMO2 cDNA ORF Clone, Mouse, C-Myc tag MG51704-CM
SUMO2 cDNA ORF Clone, Mouse, N-Myc tag MG51704-NM
SUMO2 qPCR Primer Pairs, Mouse MP201577

SUMO2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SUMO2 cDNA ORF Clone in Cloning Vector, Human HG13443-G
SUMO2 cDNA ORF Clone, Human, untagged HG13443-UT
SUMO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13443-ACG
SUMO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13443-ACGLN
SUMO2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13443-ANG
SUMO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13443-ACR
SUMO2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13443-ANR
SUMO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13443-CF
SUMO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13443-NF
SUMO2 cDNA ORF Clone, Human, C-His tag HG13443-CH
SUMO2 cDNA ORF Clone, Human, N-His tag HG13443-NH
SUMO2 cDNA ORF Clone, Human, C-HA tag HG13443-CY
SUMO2 cDNA ORF Clone, Human, C-Myc tag HG13443-CM
SUMO2 cDNA ORF Clone, Human, N-Myc tag HG13443-NM
SUMO2 qPCR Primer Pairs, Human HP102143
info info
添加购物车成功! 添加购物车失败!