PC4 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14326-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PC4 Reagents
CRO Services
Product recommended

All PC4 Reagents
PC4 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
384 bp
Description
Full length Clone DNA of Human SUB1 homolog (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PC4 cDNA ORF Clone, Human, N-Myc tag Alternative Names
p14 cDNA ORF Clone, Human;P15 cDNA ORF Clone, Human;PC4 cDNA ORF Clone, Human;RPO2TC1 cDNA ORF Clone, Human;SUB1 cDNA ORF Clone, Human
PC4 Background Information

SUB1 belongs to the transcriptional coactivator PC4 family. It is a general coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. SUB1 binds single-stranded DNA. Single-stranded DNA-binding proteins play many roles in nucleic acid metabolism, but their importance during transcription remains unclear. SUB1 exhibits strong genetic interactions with factors necessary for promoter melting. It localizes near the transcription bubble in vitro and binds to promoters in vivo dependent upon preinitiation complexes assembly. SUB1 interacts with the nontemplate strand of RNApII complexes during initiation. It may also be involved in stabilizing the multiprotein transcription complex.

Full Name
SUB1 homolog, transcriptional regulator
References
  • Knaus R, et al. (1996) Yeast SUB1 is a suppressor of TFIIB mutations and has homology to the human co-activator PC4. EMBO J. 15(8):1933-40.
  • Ge H, et al. (1994) Purification, cloning, and characterization of a human coactivator, PC4, that mediates transcriptional activation of class II genes. Cell. 78(3):513-23.
  • Kaiser K, et al. (1994) A novel mediator of class II gene transcription with homology to viral immediate-early transcriptional regulators. Cell. 78(3):525-34.
  • PC4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PC4 cDNA ORF Clone in Cloning Vector, Mouse MG53827-U
    PC4 cDNA ORF Clone, Mouse, untagged MG53827-UT
    PC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53827-ACGLN
    PC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53827-ACG
    PC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53827-ANG
    PC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53827-ACR
    PC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53827-ANR
    PC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53827-CF
    PC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53827-NF
    PC4 cDNA ORF Clone, Mouse, C-His tag MG53827-CH
    PC4 cDNA ORF Clone, Mouse, N-His tag MG53827-NH
    PC4 cDNA ORF Clone, Mouse, C-HA tag MG53827-CY
    PC4 cDNA ORF Clone, Mouse, N-HA tag MG53827-NY
    PC4 cDNA ORF Clone, Mouse, C-Myc tag MG53827-CM
    PC4 cDNA ORF Clone, Mouse, N-Myc tag MG53827-NM

    PC4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PC4 cDNA ORF Clone in Cloning Vector, Human HG14326-G
    PC4 cDNA ORF Clone, Human, untagged HG14326-UT
    PC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG14326-ACG
    PC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14326-ACGLN
    PC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG14326-ANG
    PC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG14326-ACR
    PC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG14326-ANR
    PC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14326-CF
    PC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14326-NF
    PC4 cDNA ORF Clone, Human, C-His tag HG14326-CH
    PC4 cDNA ORF Clone, Human, N-His tag HG14326-NH
    PC4 cDNA ORF Clone, Human, C-HA tag HG14326-CY
    PC4 cDNA ORF Clone, Human, N-HA tag HG14326-NY
    PC4 cDNA ORF Clone, Human, C-Myc tag HG14326-CM
    PC4 qPCR Primer Pairs, Human HP102976
    info info
    添加购物车成功! 添加购物车失败!