STOML2 cDNA ORF Clone, Human, untagged

Cat: HG16147-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All STOML2 Reagents
CRO Services
Product recommended

All STOML2 Reagents
STOML2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1071 bp
Description
Full length Clone DNA of Human stomatin (EPB72)-like 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STOML2 cDNA ORF Clone, Human, untagged Alternative Names
HSPC108 cDNA ORF Clone, Human;SLP-2 cDNA ORF Clone, Human
STOML2 Background Information
Full Name
stomatin like 2

STOML2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
STOML2 cDNA ORF Clone in Cloning Vector, Rat RG81105-U
STOML2 cDNA ORF Clone, Rat, untagged RG81105-UT
STOML2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81105-ACG
STOML2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81105-ACGLN
STOML2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81105-ANG
STOML2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81105-ACR
STOML2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81105-ANR
STOML2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81105-CF
STOML2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81105-NF
STOML2 cDNA ORF Clone, Rat, C-His tag RG81105-CH
STOML2 cDNA ORF Clone, Rat, N-His tag RG81105-NH
STOML2 cDNA ORF Clone, Rat, C-HA tag RG81105-CY
STOML2 cDNA ORF Clone, Rat, N-HA tag RG81105-NY
STOML2 cDNA ORF Clone, Rat, C-Myc tag RG81105-CM
STOML2 cDNA ORF Clone, Rat, N-Myc tag RG81105-NM
STOML2 qPCR Primer Pairs, Rat RP301062

STOML2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STOML2 cDNA ORF Clone in Cloning Vector, Human HG16147-G
STOML2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16147-ACGLN
STOML2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16147-ACG
STOML2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16147-ANG
STOML2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16147-ACR
STOML2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16147-ANR
STOML2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16147-CF
STOML2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16147-NF
STOML2 cDNA ORF Clone, Human, C-His tag HG16147-CH
STOML2 cDNA ORF Clone, Human, N-His tag HG16147-NH
STOML2 cDNA ORF Clone, Human, C-HA tag HG16147-CY
STOML2 cDNA ORF Clone, Human, N-HA tag HG16147-NY
STOML2 cDNA ORF Clone, Human, C-Myc tag HG16147-CM
STOML2 cDNA ORF Clone, Human, N-Myc tag HG16147-NM
STOML2 qPCR Primer Pairs, Human HP104916
info info
添加购物车成功! 添加购物车失败!