STK38 cDNA ORF Clone, Human, N-His tag

Cat: HG12319-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All STK38 Reagents
CRO Services
Product recommended

All STK38 Reagents
STK38 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Human serine/threonine kinase 38 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

STK38 cDNA ORF Clone, Human, N-His tag Alternative Names
NDR cDNA ORF Clone, Human;NDR1 cDNA ORF Clone, Human
STK38 Background Information
Full Name
serine/threonine kinase 38

STK38 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
STK38 cDNA ORF Clone in Cloning Vector, Mouse MG5A2615-U
STK38 cDNA ORF Clone, Mouse, untagged MG5A2615-UT
STK38 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2615-ACGLN
STK38 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2615-ACG
STK38 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2615-ANG
STK38 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2615-ACR
STK38 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2615-ANR
STK38 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2615-CF
STK38 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2615-NF
STK38 cDNA ORF Clone, Mouse, C-His tag MG5A2615-CH
STK38 cDNA ORF Clone, Mouse, N-His tag MG5A2615-NH
STK38 cDNA ORF Clone, Mouse, C-HA tag MG5A2615-CY
STK38 cDNA ORF Clone, Mouse, N-HA tag MG5A2615-NY
STK38 cDNA ORF Clone, Mouse, C-Myc tag MG5A2615-CM
STK38 cDNA ORF Clone, Mouse, N-Myc tag MG5A2615-NM

STK38 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
STK38 cDNA ORF Clone in Cloning Vector, Human HG12319-G
STK38 cDNA ORF Clone, Human, untagged HG12319-UT
STK38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12319-ACGLN
STK38 cDNA ORF Clone, Human, C-GFPSpark® tag HG12319-ACG
STK38 cDNA ORF Clone, Human, N-GFPSpark® tag HG12319-ANG
STK38 cDNA ORF Clone, Human, C-OFPSpark® tag HG12319-ACR
STK38 cDNA ORF Clone, Human, N-OFPSpark® tag HG12319-ANR
STK38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12319-CF
STK38 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12319-NF
STK38 cDNA ORF Clone, Human, C-His tag HG12319-CH
STK38 cDNA ORF Clone, Human, C-HA tag HG12319-CY
STK38 cDNA ORF Clone, Human, N-HA tag HG12319-NY
STK38 cDNA ORF Clone, Human, C-Myc tag HG12319-CM
STK38 cDNA ORF Clone, Human, N-Myc tag HG12319-NM
STK38 qPCR Primer Pairs, Human HP101920
info info
添加购物车成功! 添加购物车失败!