SPG21 cDNA ORF Clone, Human, N-HA tag

Cat: HG10522-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SPG21 Reagents
CRO Services
Product recommended

All SPG21 Reagents
SPG21 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
927 bp
Description
Full length Clone DNA of Human spastic paraplegia 21 (autosomal recessive, Mast syndrome), transcript variant 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SPG21 cDNA ORF Clone, Human, N-HA tag Alternative Names
ACP33 cDNA ORF Clone, Human;BM-019 cDNA ORF Clone, Human;GL010 cDNA ORF Clone, Human;MAST cDNA ORF Clone, Human
SPG21 Background Information

Spastic paraplegia 21 (SPG21), also known as acid Cluster Protein 33 (ACP33) and Mast syndrome protein, is a member of the AB hydrolase superfamily. Human SPG21 is a 308 amino acid residue protein widely expressed in all tissues, including heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas. SPG21 binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation via the noncatalytic alpha/beta hydrolase fold domain. SPG21 thus is proposed to play a role as a negative regulatory factor in CD4-dependent T-cell activation of CD4. Defects in SPG21 are the cause of spastic paraplegia autosomal recessive type 21, also known as Mast syndrome, a neurodegenerative disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Rate of progression and the severity of symptoms are quite variable. SPG21 is also associated with dementia and other central nervous system abnormalities.

Full Name
spastic paraplegia 21 (autosomal recessive, Mast syndrome)
References
  • Zeitlmann L. et al., 2001, J Biol Chem. 276: 9123-32.
  • Simpson M. A. et al., 2003, Am J Hum Genet. 73: 1147-156.
  • Ota T. et al., 2004, Nat. Genet.36: 40-45.
  • Kedmi M. et al., 2007, Physiol Genomics. 28: 213-22.
  • Hanna M. C. et al., 2009, Neurogenetics.10: 217-28.
  • SPG21 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SPG21 cDNA ORF Clone in Cloning Vector, Mouse MG50783-G
    SPG21 cDNA ORF Clone, Mouse, untagged MG50783-UT
    SPG21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50783-ACG
    SPG21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50783-ACGLN
    SPG21 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50783-ANG
    SPG21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50783-ACR
    SPG21 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50783-ANR
    SPG21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50783-CF
    SPG21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50783-NF
    SPG21 cDNA ORF Clone, Mouse, C-His tag MG50783-CH
    SPG21 cDNA ORF Clone, Mouse, N-His tag MG50783-NH
    SPG21 cDNA ORF Clone, Mouse, C-HA tag MG50783-CY
    SPG21 cDNA ORF Clone, Mouse, N-HA tag MG50783-NY
    SPG21 cDNA ORF Clone, Mouse, C-Myc tag MG50783-CM
    SPG21 cDNA ORF Clone, Mouse, N-Myc tag MG50783-NM
    SPG21 qPCR Primer Pairs, Mouse MP200757

    SPG21 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SPG21 cDNA ORF Clone in Cloning Vector, Human HG10522-M
    SPG21 cDNA ORF Clone, Human, untagged HG10522-UT
    SPG21 cDNA ORF Clone, Human, C-GFPSpark® tag HG10522-ACG
    SPG21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10522-ACGLN
    SPG21 cDNA ORF Clone, Human, N-GFPSpark® tag HG10522-ANG
    SPG21 cDNA ORF Clone, Human, C-OFPSpark® tag HG10522-ACR
    SPG21 cDNA ORF Clone, Human, N-OFPSpark® tag HG10522-ANR
    SPG21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10522-CF
    SPG21 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10522-NF
    SPG21 cDNA ORF Clone, Human, C-His tag HG10522-CH
    SPG21 cDNA ORF Clone, Human, N-His tag HG10522-NH
    SPG21 cDNA ORF Clone, Human, C-HA tag HG10522-CY
    SPG21 cDNA ORF Clone, Human, C-Myc tag HG10522-CM
    SPG21 cDNA ORF Clone, Human, N-Myc tag HG10522-NM
    SPG21 qPCR Primer Pairs, Human HP100539
    info info
    添加购物车成功! 添加购物车失败!