SOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG12061-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All SOD2 Reagents

CRO Services

Product recommended


All SOD2 Reagents

SOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
708 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 192C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human superoxide dismutase 2, mitochondrial with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SOD2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images

Human aFGF/FGF1 Gene Plasmid Map 5637
Human SOD2 Gene Expression validated Image 16647
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

SOD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

IPOB cDNA ORF Clone, Human;MNSOD cDNA ORF Clone, Human;MVCD6 cDNA ORF Clone, Human

SOD2 Background Information

Superoxide dismutases (SOD) are important anti-oxidant enzymes that guard against superoxide toxicity. In humans, as in all mammals and most chordates, three forms of superoxide dismutase (SOD) are present: SOD1 is located in the cytoplasm, SOD2 in the mitochondria, and SOD3 is extracellular. Mitochondrial superoxide dismutase [SOD; manganese SOD (MnSOD) or SOD2] neutralizes highly reactive superoxide radical (O(

Full Name
superoxide dismutase 2, mitochondrial
References
  • Culotta VC, et al. (2006) Activation of superoxide dismutases: putting the metal to the pedal. Biochim Biophys Acta. 1763(7): 747-58.
  • Bag A, et al. (2008) Target sequence polymorphism of human manganese superoxide dismutase gene and its association with cancer risk: a review. Cancer Epidemiol Biomarkers Prev. 17(12): 3298-305.
  • Diehl C, et al. (2009) The basis of topical superoxide dismutase antipruritic activity. Acta Dermatovenerol Croat. 17(1): 25-39.
  • Ma X, et al. (2010) No association between SOD2 Val16Ala polymorphism and breast cancer susceptibility: a meta-analysis based on 9,710 cases and 11,041 controls. Breast Cancer Res Treat. 122(2): 509-14.
  • SOD2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Rat RG81842-U
    SOD2 cDNA ORF Clone, Rat, untagged RG81842-UT
    SOD2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81842-ACG
    SOD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81842-ACGLN
    SOD2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81842-ANG
    SOD2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81842-ACR
    SOD2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81842-ANR
    SOD2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81842-CF
    SOD2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81842-NF
    SOD2 cDNA ORF Clone, Rat, C-His tag RG81842-CH
    SOD2 cDNA ORF Clone, Rat, N-His tag RG81842-NH
    SOD2 cDNA ORF Clone, Rat, C-HA tag RG81842-CY
    SOD2 cDNA ORF Clone, Rat, N-HA tag RG81842-NY
    SOD2 cDNA ORF Clone, Rat, C-Myc tag RG81842-CM
    SOD2 cDNA ORF Clone, Rat, N-Myc tag RG81842-NM

    SOD2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Mouse MG52414-G
    SOD2 cDNA ORF Clone, Mouse, untagged MG52414-UT
    SOD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52414-ACG
    SOD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52414-ACGLN
    SOD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52414-ANG
    SOD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52414-ACR
    SOD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52414-ANR
    SOD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52414-CF
    SOD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52414-NF
    SOD2 cDNA ORF Clone, Mouse, C-His tag MG52414-CH
    SOD2 cDNA ORF Clone, Mouse, N-His tag MG52414-NH
    SOD2 cDNA ORF Clone, Mouse, C-HA tag MG52414-CY
    SOD2 cDNA ORF Clone, Mouse, N-HA tag MG52414-NY
    SOD2 cDNA ORF Clone, Mouse, C-Myc tag MG52414-CM
    SOD2 cDNA ORF Clone, Mouse, N-Myc tag MG52414-NM
    SOD2 qPCR Primer Pairs, Mouse MP202287

    SOD2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SOD2 cDNA ORF Clone in Cloning Vector, Human HG12061-G
    SOD2 cDNA ORF Clone in Cloning Vector, Human HG29745-U
    SOD2 cDNA ORF Clone, Human, untagged HG12061-UT
    SOD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12061-ACGLN
    SOD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12061-ACG
    SOD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12061-ANG
    SOD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12061-ACR
    SOD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12061-ANR
    SOD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12061-CF
    SOD2 cDNA ORF Clone, Human, C-His tag HG12061-CH
    SOD2 cDNA ORF Clone, Human, N-His tag HG12061-NH
    SOD2 cDNA ORF Clone, Human, C-HA tag HG12061-CY
    SOD2 cDNA ORF Clone, Human, N-HA tag HG12061-NY
    SOD2 cDNA ORF Clone, Human, C-Myc tag HG12061-CM
    SOD2 cDNA ORF Clone, Human, N-Myc tag HG12061-NM
    SOD2 qPCR Primer Pairs, Human HP101592
    info info
    添加购物车成功! 添加购物车失败!