SNRNP27 cDNA ORF Clone, Human, N-HA tag

Cat: HG16408-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SNRNP27 Reagents
CRO Services
Product recommended

All SNRNP27 Reagents
SNRNP27 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Human small nuclear ribonucleoprotein 27kDa (U4/U6.U5) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNRNP27 cDNA ORF Clone, Human, N-HA tag Alternative Names
27K cDNA ORF Clone, Human;RY1 cDNA ORF Clone, Human
SNRNP27 Background Information
Full Name
small nuclear ribonucleoprotein 27kDa (U4/U6.U5)

SNRNP27 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SNRNP27 cDNA ORF Clone in Cloning Vector, Rhesus CG90755-G
SNRNP27 cDNA ORF Clone, Rhesus, untagged CG90755-UT
SNRNP27 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90755-ACGLN
SNRNP27 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90755-ACG
SNRNP27 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90755-ANG
SNRNP27 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90755-ACR
SNRNP27 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90755-ANR
SNRNP27 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90755-CF
SNRNP27 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90755-NF
SNRNP27 cDNA ORF Clone, Rhesus, C-His tag CG90755-CH
SNRNP27 cDNA ORF Clone, Rhesus, N-His tag CG90755-NH
SNRNP27 cDNA ORF Clone, Rhesus, C-HA tag CG90755-CY
SNRNP27 cDNA ORF Clone, Rhesus, N-HA tag CG90755-NY
SNRNP27 cDNA ORF Clone, Rhesus, C-Myc tag CG90755-CM
SNRNP27 cDNA ORF Clone, Rhesus, N-Myc tag CG90755-NM

SNRNP27 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SNRNP27 cDNA ORF Clone in Cloning Vector, Mouse MG54047-U
SNRNP27 cDNA ORF Clone, Mouse, untagged MG54047-UT
SNRNP27 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54047-ACGLN
SNRNP27 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54047-ACG
SNRNP27 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54047-ANG
SNRNP27 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54047-ACR
SNRNP27 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54047-ANR
SNRNP27 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54047-CF
SNRNP27 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54047-NF
SNRNP27 cDNA ORF Clone, Mouse, C-His tag MG54047-CH
SNRNP27 cDNA ORF Clone, Mouse, N-His tag MG54047-NH
SNRNP27 cDNA ORF Clone, Mouse, C-HA tag MG54047-CY
SNRNP27 cDNA ORF Clone, Mouse, N-HA tag MG54047-NY
SNRNP27 cDNA ORF Clone, Mouse, C-Myc tag MG54047-CM
SNRNP27 cDNA ORF Clone, Mouse, N-Myc tag MG54047-NM

SNRNP27 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SNRNP27 cDNA ORF Clone in Cloning Vector, Human HG16408-G
SNRNP27 cDNA ORF Clone, Human, untagged HG16408-UT
SNRNP27 cDNA ORF Clone, Human, C-GFPSpark® tag HG16408-ACG
SNRNP27 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16408-ACGLN
SNRNP27 cDNA ORF Clone, Human, N-GFPSpark® tag HG16408-ANG
SNRNP27 cDNA ORF Clone, Human, C-OFPSpark® tag HG16408-ACR
SNRNP27 cDNA ORF Clone, Human, N-OFPSpark® tag HG16408-ANR
SNRNP27 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16408-CF
SNRNP27 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16408-NF
SNRNP27 cDNA ORF Clone, Human, C-His tag HG16408-CH
SNRNP27 cDNA ORF Clone, Human, N-His tag HG16408-NH
SNRNP27 cDNA ORF Clone, Human, C-HA tag HG16408-CY
SNRNP27 cDNA ORF Clone, Human, C-Myc tag HG16408-CM
SNRNP27 cDNA ORF Clone, Human, N-Myc tag HG16408-NM
SNRNP27 qPCR Primer Pairs, Human HP105157
info info
添加购物车成功! 添加购物车失败!