RTN3 cDNA ORF Clone, Human, untagged

Cat: HG14259-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RTN3 Reagents
CRO Services
Product recommended

All RTN3 Reagents
RTN3 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Human reticulon 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RTN3 cDNA ORF Clone, Human, untagged Alternative Names
ASYIP cDNA ORF Clone, Human;HAP cDNA ORF Clone, Human;NSPL2 cDNA ORF Clone, Human;NSPLII cDNA ORF Clone, Human;RTN3-A1 cDNA ORF Clone, Human
RTN3 Background Information
Full Name
reticulon 3

RTN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RTN3 cDNA ORF Clone in Cloning Vector, Mouse MG51210-U
RTN3 cDNA ORF Clone, Mouse, untagged MG51210-UT
RTN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51210-ACG
RTN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51210-ACGLN
RTN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51210-ANG
RTN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51210-ACR
RTN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51210-ANR
RTN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51210-CF
RTN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51210-NF
RTN3 cDNA ORF Clone, Mouse, C-His tag MG51210-CH
RTN3 cDNA ORF Clone, Mouse, N-His tag MG51210-NH
RTN3 cDNA ORF Clone, Mouse, C-HA tag MG51210-CY
RTN3 cDNA ORF Clone, Mouse, N-HA tag MG51210-NY
RTN3 cDNA ORF Clone, Mouse, C-Myc tag MG51210-CM
RTN3 cDNA ORF Clone, Mouse, N-Myc tag MG51210-NM
RTN3 qPCR Primer Pairs, Mouse MP201094

RTN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RTN3 cDNA ORF Clone in Cloning Vector, Human HG14259-G
RTN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14259-ACGLN
RTN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14259-ACG
RTN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14259-ACR
RTN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14259-CF
RTN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14259-NF
RTN3 cDNA ORF Clone, Human, C-His tag HG14259-CH
RTN3 cDNA ORF Clone, Human, N-His tag HG14259-NH
RTN3 cDNA ORF Clone, Human, C-HA tag HG14259-CY
RTN3 cDNA ORF Clone, Human, N-HA tag HG14259-NY
RTN3 cDNA ORF Clone, Human, C-Myc tag HG14259-CM
RTN3 cDNA ORF Clone, Human, N-Myc tag HG14259-NM
RTN3 qPCR Primer Pairs, Human HP102909
info info
添加购物车成功! 添加购物车失败!