RSPO2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13084-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RSPO2 Reagents

CRO Services

Product recommended


All RSPO2 Reagents

RSPO2 cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
732 bp
Description
Full length Clone DNA of Human R-spondin 2 homolog (Xenopus laevis) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSPO2 cDNA ORF Clone, Human, N-Myc tag Alternative Names

CRISTIN2 cDNA ORF Clone, Human

RSPO2 Background Information

R-spondin-2, also known as RSPO2, synergizes with Wnt to activate beta-catenin. RSPO2 is secreted proteins that regulate beta-catenin signaling. Activator of the beta-catenin signaling cascade leads to TCF-dependent gene activation. Action both in the canonical Wnt / beta- catenin-dependent pathway, possibly via a direct interaction with Wnt proteins, and in a Wnt-independent beta catenin pathway through a receptor signaling pathway that may not use frizzled / LRP receptors. Probably also acts as a ligand for frizzled and LRP receptors. The encoding gene Rspo2 was identified as a novel common integration site for the mouse mammary tumor virus in viral induced mouse mammary tumors. Rspo2 and Rspo2 / Wnt1 tumors contained many spindle cells, consistent with an epithelial-mesenchymal transformation phenotype. When Rspo2 and Rspo2 / Wnt1 tumor cells were transferred into naive mice, they exhibited greater metastatic activity than cells derived from Wnt1 tumors.

Full Name
R-spondin 2
References
  • Cadieu E, et al. (2009) Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science. 326: 150-153.
  • Kazanskaya O, et al. (2004) R-Spondin2 is a secreted activator of Wnt / beta-catenin signaling and is required for Xenopus myogenesis. Dev Cell. 7(4): 525-34.
  • Parker HG, et al. (2010) An insertion in the RSPO2 gene correlates with improper coat in the Portuguese water dog. J Hered. 101(5):612-7.
  • RSPO2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RSPO2 cDNA ORF Clone in Cloning Vector, Mouse MG51078-G
    RSPO2 cDNA ORF Clone, Mouse, untagged MG51078-UT
    RSPO2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51078-ACG
    RSPO2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51078-ACGLN
    RSPO2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51078-ACR
    RSPO2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51078-CF
    RSPO2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51078-NF
    RSPO2 cDNA ORF Clone, Mouse, C-His tag MG51078-CH
    RSPO2 cDNA ORF Clone, Mouse, N-His tag MG51078-NH
    RSPO2 cDNA ORF Clone, Mouse, C-HA tag MG51078-CY
    RSPO2 cDNA ORF Clone, Mouse, N-HA tag MG51078-NY
    RSPO2 cDNA ORF Clone, Mouse, C-Myc tag MG51078-CM
    RSPO2 cDNA ORF Clone, Mouse, N-Myc tag MG51078-NM
    RSPO2 qPCR Primer Pairs, Mouse MP201036

    RSPO2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RSPO2 cDNA ORF Clone in Cloning Vector, Human HG13084-G
    RSPO2 cDNA ORF Clone, Human, untagged HG13084-UT
    RSPO2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13084-ACGLN
    RSPO2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13084-ACG
    RSPO2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13084-ACR
    RSPO2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13084-CF
    RSPO2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13084-NF
    RSPO2 cDNA ORF Clone, Human, C-His tag HG13084-CH
    RSPO2 cDNA ORF Clone, Human, N-His tag HG13084-NH
    RSPO2 cDNA ORF Clone, Human, C-HA tag HG13084-CY
    RSPO2 cDNA ORF Clone, Human, N-HA tag HG13084-NY
    RSPO2 cDNA ORF Clone, Human, C-Myc tag HG13084-CM
    RSPO2 qPCR Primer Pairs, Human HP101701
    info info
    添加购物车成功! 添加购物车失败!