RPE cDNA ORF Clone, Human, untagged

Cat: HG14238-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPE Reagents
CRO Services
Product recommended

All RPE Reagents
RPE cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human ribulose-5-phosphate-3-epimerase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPE cDNA ORF Clone, Human, untagged Alternative Names
RPE2-1 cDNA ORF Clone, Human
RPE Background Information

The "ribulose phosphate binding" superfamily defined by the Structural Classification of Proteins (SCOP) database is considered the result of divergent evolution from a common (beta/alpha)(8)-barrel ancestor. The superfamily includes d-ribulose 5-phosphate 3-epimerase (RPE), orotidine 5'-monophosphate decarboxylase (OMPDC), and 3-keto-l-gulonate 6-phosphate decarboxylase (KGPDC). Replication of the human genome requires the activation of thousands of replicons distributed along each one of the chromosomes. Each replicon contains an initiation, or origin, site, at which DNA synthesis begins. In enzymology, a L-ribulose-5-phosphate 3-epimerase is an enzyme that catalyzes the chemical reaction L-ribulose 5-phosphate to L-xylulose 5-phosphate. Hence, RPE has one substrate, L-ribulose 5-phosphate, and one product, L-xylulose 5-phosphate. RPE belongs to the family of isomerases, specifically those racemases and epimerases acting on carbohydrates and derivatives. The systematic name of this enzyme class is L-ribulose-5-phosphate 3-epimerase. Other names in common use include L-xylulose 5-phosphate 3-epimerase, UlaE, and SgaU.

Full Name
ribulose-5-phosphate-3-epimerase
References
  • Yew WS, et al., 2002,  J. Bacteriol. 184 (1): 302-6.
  • Shimaoka, M. et al., 2005, Biosci Biotechnol Biochem  69 (7):1248-55.
  • Salinero,KK. et al., 2009,  BMC Genomics 10 :351.
  • RPE cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    RPE cDNA ORF Clone in Cloning Vector, Rabbit TG65078-G
    RPE cDNA ORF Clone, Rabbit, untagged TG65078-UT
    RPE cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65078-ACG
    RPE cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65078-ANG
    RPE cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65078-ACR
    RPE cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65078-ANR
    RPE cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65078-CF
    RPE cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65078-NF
    RPE cDNA ORF Clone, Rabbit, C-His tag TG65078-CH
    RPE cDNA ORF Clone, Rabbit, N-His tag TG65078-NH
    RPE cDNA ORF Clone, Rabbit, C-HA tag TG65078-CY
    RPE cDNA ORF Clone, Rabbit, N-HA tag TG65078-NY
    RPE cDNA ORF Clone, Rabbit, C-Myc tag TG65078-CM
    RPE cDNA ORF Clone, Rabbit, N-Myc tag TG65078-NM

    RPE cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RPE cDNA ORF Clone in Cloning Vector, Mouse MG50968-G
    RPE cDNA ORF Clone, Mouse, untagged MG50968-UT
    RPE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50968-ACG
    RPE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50968-ACGLN
    RPE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50968-ACR
    RPE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50968-CF
    RPE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50968-NF
    RPE cDNA ORF Clone, Mouse, C-His tag MG50968-CH
    RPE cDNA ORF Clone, Mouse, N-His tag MG50968-NH
    RPE cDNA ORF Clone, Mouse, C-HA tag MG50968-CY
    RPE cDNA ORF Clone, Mouse, N-HA tag MG50968-NY
    RPE cDNA ORF Clone, Mouse, C-Myc tag MG50968-CM
    RPE cDNA ORF Clone, Mouse, N-Myc tag MG50968-NM
    RPE qPCR Primer Pairs, Mouse MP200937

    RPE cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RPE cDNA ORF Clone in Cloning Vector, Human HG14238-G
    RPE cDNA ORF Clone, Human, C-GFPSpark® tag HG14238-ACG
    RPE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14238-ACGLN
    RPE cDNA ORF Clone, Human, C-OFPSpark® tag HG14238-ACR
    RPE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14238-CF
    RPE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14238-NF
    RPE cDNA ORF Clone, Human, C-His tag HG14238-CH
    RPE cDNA ORF Clone, Human, N-His tag HG14238-NH
    RPE cDNA ORF Clone, Human, C-HA tag HG14238-CY
    RPE cDNA ORF Clone, Human, N-HA tag HG14238-NY
    RPE cDNA ORF Clone, Human, C-Myc tag HG14238-CM
    RPE cDNA ORF Clone, Human, N-Myc tag HG14238-NM
    RPE qPCR Primer Pairs, Human HP102888
    info info
    添加购物车成功! 添加购物车失败!