RAB25 cDNA ORF Clone, Human, untagged

Cat: HG14236-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB25 Reagents
CRO Services
Product recommended

All RAB25 Reagents
RAB25 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
642 bp
Description
Full length Clone DNA of Human RAB25, member RAS oncogene family.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB25 cDNA ORF Clone, Human, untagged Alternative Names
CATX-8 cDNA ORF Clone, Human;RAB11C cDNA ORF Clone, Human
RAB25 Background Information
Full Name
RAB25, member RAS oncogene family

RAB25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB25 cDNA ORF Clone in Cloning Vector, Rat RG80506-U
RAB25 cDNA ORF Clone, Rat, untagged RG80506-UT
RAB25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80506-ACG
RAB25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80506-ACGLN
RAB25 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80506-ANG
RAB25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80506-ACR
RAB25 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80506-ANR
RAB25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80506-CF
RAB25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80506-NF
RAB25 cDNA ORF Clone, Rat, C-His tag RG80506-CH
RAB25 cDNA ORF Clone, Rat, N-His tag RG80506-NH
RAB25 cDNA ORF Clone, Rat, C-HA tag RG80506-CY
RAB25 cDNA ORF Clone, Rat, N-HA tag RG80506-NY
RAB25 cDNA ORF Clone, Rat, C-Myc tag RG80506-CM
RAB25 cDNA ORF Clone, Rat, N-Myc tag RG80506-NM
RAB25 qPCR Primer Pairs, Rat RP300470

RAB25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB25 cDNA ORF Clone in Cloning Vector, Mouse MG53523-G
RAB25 cDNA ORF Clone, Mouse, untagged MG53523-UT
RAB25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53523-ACG
RAB25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53523-ACGLN
RAB25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53523-ACR
RAB25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53523-CF
RAB25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53523-NF
RAB25 cDNA ORF Clone, Mouse, C-His tag MG53523-CH
RAB25 cDNA ORF Clone, Mouse, N-His tag MG53523-NH
RAB25 cDNA ORF Clone, Mouse, C-HA tag MG53523-CY
RAB25 cDNA ORF Clone, Mouse, N-HA tag MG53523-NY
RAB25 cDNA ORF Clone, Mouse, C-Myc tag MG53523-CM
RAB25 cDNA ORF Clone, Mouse, N-Myc tag MG53523-NM

RAB25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB25 cDNA ORF Clone in Cloning Vector, Human HG14236-G
RAB25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14236-ACGLN
RAB25 cDNA ORF Clone, Human, C-GFPSpark® tag HG14236-ACG
RAB25 cDNA ORF Clone, Human, N-GFPSpark® tag HG14236-ANG
RAB25 cDNA ORF Clone, Human, C-OFPSpark® tag HG14236-ACR
RAB25 cDNA ORF Clone, Human, N-OFPSpark® tag HG14236-ANR
RAB25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14236-CF
RAB25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14236-NF
RAB25 cDNA ORF Clone, Human, C-His tag HG14236-CH
RAB25 cDNA ORF Clone, Human, N-His tag HG14236-NH
RAB25 cDNA ORF Clone, Human, C-HA tag HG14236-CY
RAB25 cDNA ORF Clone, Human, N-HA tag HG14236-NY
RAB25 cDNA ORF Clone, Human, C-Myc tag HG14236-CM
RAB25 cDNA ORF Clone, Human, N-Myc tag HG14236-NM
RAB25 qPCR Primer Pairs, Human HP102886
info info
添加购物车成功! 添加购物车失败!