SHP2 cDNA ORF Clone, Human, N-His tag

Cat: HG12318-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SHP2 Reagents
CRO Services
Product recommended

All SHP2 Reagents
SHP2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1383 bp
Description
Full length Clone DNA of Human protein tyrosine phosphatase, non-receptor type 11 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SHP2 cDNA ORF Clone, Human, N-His tag Alternative Names
BPTP3 cDNA ORF Clone, Human;CFC cDNA ORF Clone, Human;NS1 cDNA ORF Clone, Human;PTP-1D cDNA ORF Clone, Human;PTP2C cDNA ORF Clone, Human;SH-PTP2 cDNA ORF Clone, Human;SH-PTP3 cDNA ORF Clone, Human;SHP2 cDNA ORF Clone, Human
SHP2 Background Information

SHP2, also known as PTPN11, belongs to the protein-tyrosine phosphatase(PTP) family, non-receptor class 2 subfamily. PTPs catalyze the removal of phosphate groups from tyrosine residues by the hydrolysis of phosphoric acid monoesters. They dephosphorylate EGFR, JAK2 and TYK2 kinases, promoting oncogenic transformation. SHP2 is widely expressed, with highest levels in heart, brain, and skeletal muscle. SHP2 acts downstream of various receptor and cytoplasmic protein tyrosine kinases to participate in the signal transduction from the cell surface to the nucleus. It also dephosphorylates ROCK2 at Tyr-722 resulting in stimulatation of its RhoA binding activity.

Full Name
protein tyrosine phosphatase, non-receptor type 11
References
  • Ganju R K, et al. (2000) Beta-chemokine receptor CCR5 signals through SHP1, SHP2, and Syk. J Biol Chem. 275(23):17263-8.
  • Yin T, et al. (1997) Molecular characterization of specific interactions between SHP-2 phosphatase and JAK tyrosine kinases. J Biol Chem. 272(2):1032-7.
  • Kontaridis MI, et al. (2006) PTPN11 (Shp2) mutations in LEOPARD syndrome have dominant negative, not activating, effects. J Biol Chem. 281(10):6785-92.
  • SHP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SHP2 cDNA ORF Clone in Cloning Vector, Mouse MG50462-M
    SHP2 cDNA ORF Clone, Mouse, untagged MG50462-UT
    SHP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50462-ACG
    SHP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50462-ACGLN
    SHP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50462-ANG
    SHP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50462-ACR
    SHP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50462-ANR
    SHP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50462-CF
    SHP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50462-NF
    SHP2 cDNA ORF Clone, Mouse, C-His tag MG50462-CH
    SHP2 cDNA ORF Clone, Mouse, N-His tag MG50462-NH
    SHP2 cDNA ORF Clone, Mouse, C-HA tag MG50462-CY
    SHP2 cDNA ORF Clone, Mouse, N-HA tag MG50462-NY
    SHP2 cDNA ORF Clone, Mouse, C-Myc tag MG50462-CM
    SHP2 cDNA ORF Clone, Mouse, N-Myc tag MG50462-NM
    SHP2 qPCR Primer Pairs, Mouse MP200465

    SHP2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SHP2 cDNA ORF Clone in Cloning Vector, Human HG12318-G
    SHP2 cDNA ORF Clone, Human, untagged HG12318-UT
    SHP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12318-ACGLN
    SHP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG12318-ACG
    SHP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG12318-ANG
    SHP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG12318-ACR
    SHP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG12318-ANR
    SHP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12318-CF
    SHP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12318-NF
    SHP2 cDNA ORF Clone, Human, C-His tag HG12318-CH
    SHP2 cDNA ORF Clone, Human, C-HA tag HG12318-CY
    SHP2 cDNA ORF Clone, Human, N-HA tag HG12318-NY
    SHP2 cDNA ORF Clone, Human, C-Myc tag HG12318-CM
    SHP2 cDNA ORF Clone, Human, N-Myc tag HG12318-NM
    SHP2 qPCR Primer Pairs, Human HP101919
    info info
    添加购物车成功! 添加购物车失败!