p23 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14159-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All p23 Reagents
CRO Services
Product recommended

All p23 Reagents
p23 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
483 bp
Description
Full length Clone DNA of Human prostaglandin E synthase 3 (cytosolic) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p23 cDNA ORF Clone, Human, C-Myc tag Alternative Names
cPGES cDNA ORF Clone, Human;P23 cDNA ORF Clone, Human;TEBP cDNA ORF Clone, Human
p23 Background Information
Full Name
prostaglandin E synthase 3 (cytosolic)

p23 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
p23 cDNA ORF Clone in Cloning Vector, Rhesus CG90698-G
p23 cDNA ORF Clone, Rhesus, untagged CG90698-UT
p23 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90698-ACG
p23 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90698-ACGLN
p23 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90698-ANG
p23 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90698-ACR
p23 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90698-ANR
p23 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90698-CF
p23 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90698-NF
p23 cDNA ORF Clone, Rhesus, C-His tag CG90698-CH
p23 cDNA ORF Clone, Rhesus, N-His tag CG90698-NH
p23 cDNA ORF Clone, Rhesus, C-HA tag CG90698-CY
p23 cDNA ORF Clone, Rhesus, N-HA tag CG90698-NY
p23 cDNA ORF Clone, Rhesus, C-Myc tag CG90698-CM
p23 cDNA ORF Clone, Rhesus, N-Myc tag CG90698-NM

p23 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
p23 cDNA ORF Clone in Cloning Vector, Rat RG82747-U
p23 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82747-ACGLN

p23 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
p23 cDNA ORF Clone in Cloning Vector, Human HG14159-G
p23 cDNA ORF Clone, Human, untagged HG14159-UT
p23 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14159-ACGLN
p23 cDNA ORF Clone, Human, C-GFPSpark® tag HG14159-ACG
p23 cDNA ORF Clone, Human, N-GFPSpark® tag HG14159-ANG
p23 cDNA ORF Clone, Human, C-OFPSpark® tag HG14159-ACR
p23 cDNA ORF Clone, Human, N-OFPSpark® tag HG14159-ANR
p23 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14159-CF
p23 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14159-NF
p23 cDNA ORF Clone, Human, C-His tag HG14159-CH
p23 cDNA ORF Clone, Human, N-His tag HG14159-NH
p23 cDNA ORF Clone, Human, C-HA tag HG14159-CY
p23 cDNA ORF Clone, Human, N-HA tag HG14159-NY
p23 cDNA ORF Clone, Human, N-Myc tag HG14159-NM
p23 qPCR Primer Pairs, Human HP102810
info info
添加购物车成功! 添加购物车失败!