PSMB8 cDNA ORF Clone, Human, untagged

Cat: HG12028-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMB8 Reagents
CRO Services
Product recommended

All PSMB8 Reagents
PSMB8 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
819 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional peptidase 7).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.82kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSMB8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB8 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
PSMB8 cDNA ORF Clone, Human, untagged Alternative Names
ALDD cDNA ORF Clone, Human;D6S216 cDNA ORF Clone, Human;D6S216E cDNA ORF Clone, Human;JMP cDNA ORF Clone, Human;LMP7 cDNA ORF Clone, Human;NKJO cDNA ORF Clone, Human;PSMB5i cDNA ORF Clone, Human;RING10 cDNA ORF Clone, Human
PSMB8 Background Information
Full Name
proteasome (prosome, macropain) subunit, beta type, 8

PSMB8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB8 cDNA ORF Clone in Cloning Vector, Mouse MG53289-U
PSMB8 cDNA ORF Clone, Mouse, untagged MG53289-UT
PSMB8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53289-ACG
PSMB8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53289-ACGLN
PSMB8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53289-ANG
PSMB8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53289-ACR
PSMB8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53289-ANR
PSMB8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53289-CF
PSMB8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53289-NF
PSMB8 cDNA ORF Clone, Mouse, C-His tag MG53289-CH
PSMB8 cDNA ORF Clone, Mouse, N-His tag MG53289-NH
PSMB8 cDNA ORF Clone, Mouse, C-HA tag MG53289-CY
PSMB8 cDNA ORF Clone, Mouse, N-HA tag MG53289-NY
PSMB8 cDNA ORF Clone, Mouse, C-Myc tag MG53289-CM
PSMB8 cDNA ORF Clone, Mouse, N-Myc tag MG53289-NM

PSMB8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB8 cDNA ORF Clone in Cloning Vector, Human HG12028-G
PSMB8 cDNA ORF Clone, Human, C-GFPSpark® tag HG12028-ACG
PSMB8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12028-ACGLN
PSMB8 cDNA ORF Clone, Human, N-GFPSpark® tag HG12028-ANG
PSMB8 cDNA ORF Clone, Human, C-OFPSpark® tag HG12028-ACR
PSMB8 cDNA ORF Clone, Human, N-OFPSpark® tag HG12028-ANR
PSMB8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12028-CF
PSMB8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12028-NF
PSMB8 cDNA ORF Clone, Human, C-His tag HG12028-CH
PSMB8 cDNA ORF Clone, Human, N-His tag HG12028-NH
PSMB8 cDNA ORF Clone, Human, C-HA tag HG12028-CY
PSMB8 cDNA ORF Clone, Human, N-HA tag HG12028-NY
PSMB8 cDNA ORF Clone, Human, C-Myc tag HG12028-CM
PSMB8 cDNA ORF Clone, Human, N-Myc tag HG12028-NM
PSMB8 qPCR Primer Pairs, Human HP101564
info info
添加购物车成功! 添加购物车失败!