PSMB5 cDNA ORF Clone, Human, C-HA tag

Cat: HG15160-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All PSMB5 Reagents

CRO Services

Product recommended


All PSMB5 Reagents

PSMB5 cDNA ORF Clone, Human, C-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) subunit, beta type, 5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMB5 cDNA ORF Clone, Human, C-HA tag Alternative Names

LMPX cDNA ORF Clone, Human;MB1 cDNA ORF Clone, Human;X cDNA ORF Clone, Human

PSMB5 Background Information

Full Name
proteasome (prosome, macropain) subunit, beta type, 5

PSMB5 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PSMB5 cDNA ORF Clone in Cloning Vector, Canine DG70247-U
PSMB5 cDNA ORF Clone, Canine, untagged DG70247-UT
PSMB5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70247-ACGLN
PSMB5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70247-ACG
PSMB5 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70247-ANG
PSMB5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70247-ACR
PSMB5 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70247-ANR
PSMB5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70247-CF
PSMB5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70247-NF
PSMB5 cDNA ORF Clone, Canine, C-His tag DG70247-CH
PSMB5 cDNA ORF Clone, Canine, N-His tag DG70247-NH
PSMB5 cDNA ORF Clone, Canine, C-HA tag DG70247-CY
PSMB5 cDNA ORF Clone, Canine, N-HA tag DG70247-NY
PSMB5 cDNA ORF Clone, Canine, C-Myc tag DG70247-CM
PSMB5 cDNA ORF Clone, Canine, N-Myc tag DG70247-NM

PSMB5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMB5 cDNA ORF Clone in Cloning Vector, Rat RG81457-G

PSMB5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMB5 cDNA ORF Clone in Cloning Vector, Mouse MG53419-U
PSMB5 cDNA ORF Clone, Mouse, untagged MG53419-UT
PSMB5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53419-ACGLN
PSMB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53419-ACG
PSMB5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53419-ANG
PSMB5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53419-ACR
PSMB5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53419-ANR
PSMB5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53419-CF
PSMB5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53419-NF
PSMB5 cDNA ORF Clone, Mouse, C-His tag MG53419-CH
PSMB5 cDNA ORF Clone, Mouse, N-His tag MG53419-NH
PSMB5 cDNA ORF Clone, Mouse, C-HA tag MG53419-CY
PSMB5 cDNA ORF Clone, Mouse, N-HA tag MG53419-NY
PSMB5 cDNA ORF Clone, Mouse, C-Myc tag MG53419-CM
PSMB5 cDNA ORF Clone, Mouse, N-Myc tag MG53419-NM

PSMB5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMB5 cDNA ORF Clone in Cloning Vector, Human HG15160-G
PSMB5 cDNA ORF Clone, Human, untagged HG15160-UT
PSMB5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15160-ACG
PSMB5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15160-ACGLN
PSMB5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15160-ANG
PSMB5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15160-ACR
PSMB5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15160-ANR
PSMB5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15160-CF
PSMB5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15160-NF
PSMB5 cDNA ORF Clone, Human, C-His tag HG15160-CH
PSMB5 cDNA ORF Clone, Human, N-His tag HG15160-NH
PSMB5 cDNA ORF Clone, Human, N-HA tag HG15160-NY
PSMB5 cDNA ORF Clone, Human, C-Myc tag HG15160-CM
PSMB5 cDNA ORF Clone, Human, N-Myc tag HG15160-NM
PSMB5 qPCR Primer Pairs, Human HP103787
info info
添加购物车成功! 添加购物车失败!