PSMA4 cDNA ORF Clone, Human, N-HA tag

Cat: HG16401-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PSMA4 Reagents

CRO Services

Product recommended


All PSMA4 Reagents

PSMA4 cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) subunit, alpha type, 4 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA4 cDNA ORF Clone, Human, N-HA tag Alternative Names

HC9 cDNA ORF Clone, Human;HsT17706 cDNA ORF Clone, Human;PSC9 cDNA ORF Clone, Human

PSMA4 Background Information

Full Name
proteasome (prosome, macropain) subunit, alpha type, 4

PSMA4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMA4 cDNA ORF Clone in Cloning Vector, Rat RG85271-U
PSMA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85271-ACGLN

PSMA4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA4 cDNA ORF Clone in Cloning Vector, Mouse MG5A2390-U
PSMA4 cDNA ORF Clone, Mouse, untagged MG5A2390-UT
PSMA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2390-ACGLN
PSMA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2390-ACG
PSMA4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2390-ANG
PSMA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2390-ACR
PSMA4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2390-ANR
PSMA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2390-CF
PSMA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2390-NF
PSMA4 cDNA ORF Clone, Mouse, C-His tag MG5A2390-CH
PSMA4 cDNA ORF Clone, Mouse, N-His tag MG5A2390-NH
PSMA4 cDNA ORF Clone, Mouse, C-HA tag MG5A2390-CY
PSMA4 cDNA ORF Clone, Mouse, N-HA tag MG5A2390-NY
PSMA4 cDNA ORF Clone, Mouse, C-Myc tag MG5A2390-CM
PSMA4 cDNA ORF Clone, Mouse, N-Myc tag MG5A2390-NM

PSMA4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA4 cDNA ORF Clone in Cloning Vector, Human HG16401-G
PSMA4 cDNA ORF Clone, Human, untagged HG16401-UT
PSMA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16401-ACGLN
PSMA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG16401-ACG
PSMA4 cDNA ORF Clone, Human, N-GFPSpark® tag HG16401-ANG
PSMA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG16401-ACR
PSMA4 cDNA ORF Clone, Human, N-OFPSpark® tag HG16401-ANR
PSMA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16401-CF
PSMA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16401-NF
PSMA4 cDNA ORF Clone, Human, C-His tag HG16401-CH
PSMA4 cDNA ORF Clone, Human, N-His tag HG16401-NH
PSMA4 cDNA ORF Clone, Human, C-HA tag HG16401-CY
PSMA4 cDNA ORF Clone, Human, C-Myc tag HG16401-CM
PSMA4 cDNA ORF Clone, Human, N-Myc tag HG16401-NM
PSMA4 qPCR Primer Pairs, Human HP105150
info info
添加购物车成功! 添加购物车失败!