PSMA1 cDNA ORF Clone, Human, untagged

Cat: HG16142-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSMA1 Reagents
CRO Services
Product recommended

All PSMA1 Reagents
PSMA1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Human proteasome (prosome, macropain) subunit, alpha type, 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSMA1 cDNA ORF Clone, Human, untagged Alternative Names
HC2 cDNA ORF Clone, Human;HEL-S-275 cDNA ORF Clone, Human;NU cDNA ORF Clone, Human;PROS30 cDNA ORF Clone, Human
PSMA1 Background Information
Full Name
proteasome (prosome, macropain) subunit, alpha type, 1

PSMA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PSMA1 cDNA ORF Clone in Cloning Vector, Rat RG85602-U
PSMA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85602-ACGLN

PSMA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PSMA1 cDNA ORF Clone in Cloning Vector, Mouse MG53871-U
PSMA1 cDNA ORF Clone, Mouse, untagged MG53871-UT
PSMA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53871-ACGLN
PSMA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53871-ACG
PSMA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53871-ANG
PSMA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53871-ACR
PSMA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53871-ANR
PSMA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53871-CF
PSMA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53871-NF
PSMA1 cDNA ORF Clone, Mouse, C-His tag MG53871-CH
PSMA1 cDNA ORF Clone, Mouse, N-His tag MG53871-NH
PSMA1 cDNA ORF Clone, Mouse, C-HA tag MG53871-CY
PSMA1 cDNA ORF Clone, Mouse, N-HA tag MG53871-NY
PSMA1 cDNA ORF Clone, Mouse, C-Myc tag MG53871-CM
PSMA1 cDNA ORF Clone, Mouse, N-Myc tag MG53871-NM

PSMA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PSMA1 cDNA ORF Clone in Cloning Vector, Human HG16142-G
PSMA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16142-ACG
PSMA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16142-ACGLN
PSMA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16142-ANG
PSMA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16142-ACR
PSMA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16142-ANR
PSMA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16142-CF
PSMA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16142-NF
PSMA1 cDNA ORF Clone, Human, C-His tag HG16142-CH
PSMA1 cDNA ORF Clone, Human, N-His tag HG16142-NH
PSMA1 cDNA ORF Clone, Human, C-HA tag HG16142-CY
PSMA1 cDNA ORF Clone, Human, N-HA tag HG16142-NY
PSMA1 cDNA ORF Clone, Human, C-Myc tag HG16142-CM
PSMA1 cDNA ORF Clone, Human, N-Myc tag HG16142-NM
PSMA1 qPCR Primer Pairs, Human HP104912
info info
添加购物车成功! 添加购物车失败!