EPCR cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13320-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All EPCR Reagents
CRO Services
Product recommended

All EPCR Reagents
EPCR cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human protein C receptor, endothelial (EPCR) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + NotI (6kb + 0.77kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EPCR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EPCR cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Epcr/PROCR Gene Expression validated Image 1949
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human STAT3 Gene Plasmid Map 5680
EPCR cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CCCA cDNA ORF Clone, Human;CCD41 cDNA ORF Clone, Human;EPCR cDNA ORF Clone, Human
EPCR Background Information

Endothelial protein C receptor (EPCR), also known as activated protein C receptor (APC receptor) or PROCR, is a receptor for Protein C. Protein C plays an important role in many metabolism processes in humans and other animals after activated by binding to Endothelial protein C receptor (EPCR). Because of the EPCR is found primarily on endothelial cells (cells on the inside of blood vessels), activated protein C is found maily near endothelial cells. Protein C is pleiotropic, with two main functions: anticoagulation and cytoprotection. Which function will be performed depend on whether or not protein C remains bind to EPCR after activated. The anticoagulation occurs when it does not. In this case, protein C functions as an anticoagulant by irreversibly proteolytically inactivating Factor Va and Factor VIIIa, turning them into Factor Vi and Factor VIIIi respectively. When still bound to EPCR, activated protein C performs its cytoprotective effects, acting on the effector substrate PAR-1, protease-activated receptor-1. To a degree, APC's anticoagulant properties are independent of its cytoprotective ones, in that expression of one pathway is not affected by the existence of the other. 

Full Name
protein C receptor, endothelial
References
  • Nicolaes GA, et al. (2003). Congenital and acquired activated protein C resistance. Semin Vasc Med. 3 (1): 33-46.
  • Esmon CT. ( 2003). The protein C pathway. Chest 124 (3): 26-32.
  • Mosnier LO, et al. (2007)The cytoprotective protein C pathway. Blood. 109: 3161-72.
  • EPCR cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    EPCR cDNA ORF Clone in Cloning Vector, Rhesus CG90229-G
    EPCR cDNA ORF Clone, Rhesus, untagged CG90229-UT
    EPCR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90229-ACG
    EPCR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90229-ACGLN
    EPCR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90229-ACR
    EPCR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90229-CF
    EPCR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90229-NF
    EPCR cDNA ORF Clone, Rhesus, C-His tag CG90229-CH
    EPCR cDNA ORF Clone, Rhesus, N-His tag CG90229-NH
    EPCR cDNA ORF Clone, Rhesus, C-HA tag CG90229-CY
    EPCR cDNA ORF Clone, Rhesus, N-HA tag CG90229-NY
    EPCR cDNA ORF Clone, Rhesus, C-Myc tag CG90229-CM
    EPCR cDNA ORF Clone, Rhesus, N-Myc tag CG90229-NM

    EPCR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    EPCR cDNA ORF Clone in Cloning Vector, Rat RG80362-U
    EPCR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80362-ACGLN
    EPCR qPCR Primer Pairs, Rat RP300332

    EPCR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EPCR cDNA ORF Clone in Cloning Vector, Mouse MG50874-G
    EPCR cDNA ORF Clone, Mouse, untagged MG50874-UT
    EPCR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50874-ACG
    EPCR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50874-ACGLN
    EPCR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50874-ACR
    EPCR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50874-CF
    EPCR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50874-NF
    EPCR cDNA ORF Clone, Mouse, C-His tag MG50874-CH
    EPCR cDNA ORF Clone, Mouse, N-His tag MG50874-NH
    EPCR cDNA ORF Clone, Mouse, C-HA tag MG50874-CY
    EPCR cDNA ORF Clone, Mouse, N-HA tag MG50874-NY
    EPCR cDNA ORF Clone, Mouse, C-Myc tag MG50874-CM
    EPCR cDNA ORF Clone, Mouse, N-Myc tag MG50874-NM
    EPCR qPCR Primer Pairs, Mouse MP200845

    EPCR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EPCR cDNA ORF Clone in Cloning Vector, Human HG13320-G
    EPCR cDNA ORF Clone, Human, untagged HG13320-UT
    EPCR cDNA ORF Clone, Human, C-GFPSpark® tag HG13320-ACG
    EPCR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13320-ACGLN
    EPCR cDNA ORF Clone, Human, C-OFPSpark® tag HG13320-ACR
    EPCR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13320-NF
    EPCR cDNA ORF Clone, Human, C-His tag HG13320-CH
    EPCR cDNA ORF Clone, Human, N-His tag HG13320-NH
    EPCR cDNA ORF Clone, Human, C-HA tag HG13320-CY
    EPCR cDNA ORF Clone, Human, N-HA tag HG13320-NY
    EPCR cDNA ORF Clone, Human, C-Myc tag HG13320-CM
    EPCR cDNA ORF Clone, Human, N-Myc tag HG13320-NM
    EPCR qPCR Primer Pairs, Human HP102026
    info info
    添加购物车成功! 添加购物车失败!