PFDN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15092-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PFDN1 Reagents
CRO Services
Product recommended

All PFDN1 Reagents
PFDN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
369 bp
Description
Full length Clone DNA of Human prefoldin subunit 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PFDN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
PDF cDNA ORF Clone, Human;PFD1 cDNA ORF Clone, Human
PFDN1 Background Information
Full Name
prefoldin subunit 1

PFDN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PFDN1 cDNA ORF Clone in Cloning Vector, Mouse MG51321-U
PFDN1 cDNA ORF Clone, Mouse, untagged MG51321-UT
PFDN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51321-ACGLN
PFDN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51321-ACG
PFDN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51321-ANG
PFDN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51321-ACR
PFDN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51321-ANR
PFDN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51321-CF
PFDN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51321-NF
PFDN1 cDNA ORF Clone, Mouse, C-His tag MG51321-CH
PFDN1 cDNA ORF Clone, Mouse, N-His tag MG51321-NH
PFDN1 cDNA ORF Clone, Mouse, C-HA tag MG51321-CY
PFDN1 cDNA ORF Clone, Mouse, N-HA tag MG51321-NY
PFDN1 cDNA ORF Clone, Mouse, C-Myc tag MG51321-CM
PFDN1 cDNA ORF Clone, Mouse, N-Myc tag MG51321-NM
PFDN1 qPCR Primer Pairs, Mouse MP201198

PFDN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PFDN1 cDNA ORF Clone in Cloning Vector, Human HG15092-G
PFDN1 cDNA ORF Clone, Human, untagged HG15092-UT
PFDN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15092-ACGLN
PFDN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15092-ACG
PFDN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15092-ANG
PFDN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15092-ACR
PFDN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15092-ANR
PFDN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15092-NF
PFDN1 cDNA ORF Clone, Human, C-His tag HG15092-CH
PFDN1 cDNA ORF Clone, Human, N-His tag HG15092-NH
PFDN1 cDNA ORF Clone, Human, C-HA tag HG15092-CY
PFDN1 cDNA ORF Clone, Human, N-HA tag HG15092-NY
PFDN1 cDNA ORF Clone, Human, C-Myc tag HG15092-CM
PFDN1 cDNA ORF Clone, Human, N-Myc tag HG15092-NM
PFDN1 qPCR Primer Pairs, Human HP103719
info info
添加购物车成功! 添加购物车失败!