PEX5 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15085-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PEX5 Reagents
CRO Services
Product recommended

All PEX5 Reagents
PEX5 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Human peroxisomal biogenesis factor 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PEX5 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
PBD2A cDNA ORF Clone, Human;PBD2B cDNA ORF Clone, Human;PTS1-BP cDNA ORF Clone, Human;PTS1R cDNA ORF Clone, Human;PXR1 cDNA ORF Clone, Human
PEX5 Background Information
Full Name
peroxisomal biogenesis factor 5

PEX5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PEX5 cDNA ORF Clone in Cloning Vector, Mouse MG58729-U
PEX5 cDNA ORF Clone, Mouse, untagged MG58729-UT
PEX5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58729-ACGLN
PEX5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58729-ACG
PEX5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58729-ANG
PEX5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58729-ACR
PEX5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58729-ANR
PEX5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58729-CF
PEX5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58729-NF
PEX5 cDNA ORF Clone, Mouse, C-His tag MG58729-CH
PEX5 cDNA ORF Clone, Mouse, N-His tag MG58729-NH
PEX5 cDNA ORF Clone, Mouse, C-HA tag MG58729-CY
PEX5 cDNA ORF Clone, Mouse, N-HA tag MG58729-NY
PEX5 cDNA ORF Clone, Mouse, C-Myc tag MG58729-CM
PEX5 cDNA ORF Clone, Mouse, N-Myc tag MG58729-NM

PEX5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PEX5 cDNA ORF Clone in Cloning Vector, Human HG15085-G
PEX5 cDNA ORF Clone, Human, untagged HG15085-UT
PEX5 cDNA ORF Clone, Human, C-GFPSpark® tag HG15085-ACG
PEX5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15085-ACGLN
PEX5 cDNA ORF Clone, Human, N-GFPSpark® tag HG15085-ANG
PEX5 cDNA ORF Clone, Human, C-OFPSpark® tag HG15085-ACR
PEX5 cDNA ORF Clone, Human, N-OFPSpark® tag HG15085-ANR
PEX5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15085-NF
PEX5 cDNA ORF Clone, Human, C-His tag HG15085-CH
PEX5 cDNA ORF Clone, Human, N-His tag HG15085-NH
PEX5 cDNA ORF Clone, Human, C-HA tag HG15085-CY
PEX5 cDNA ORF Clone, Human, N-HA tag HG15085-NY
PEX5 cDNA ORF Clone, Human, C-Myc tag HG15085-CM
PEX5 cDNA ORF Clone, Human, N-Myc tag HG15085-NM
PEX5 qPCR Primer Pairs, Human HP103712
info info
添加购物车成功! 添加购物车失败!